1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
77julia77 [94]
2 years ago
11

Help please and thank you :)

Biology
1 answer:
Vinil7 [7]2 years ago
5 0

Answer:

A

Explanation:

You might be interested in
What is the term for all the types of alleles that exist in a popultaion
lapo4ka [179]

Answer:

<h3>The Collective Set of Alleles in a Population Is Its Gene Pool. </h3>

Explanation:

7 0
3 years ago
Structures that have different functions in different species but develop from the same embryonic tissues are called ___________
gladu [14]
Its a Homologous structure
3 0
3 years ago
Read 2 more answers
The most common elements for life are
pashok25 [27]

Answer:

Carbon

Explanation:

Because Co i think stands for copper

8 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Natural selection is a common mechanism for proposing how evolution occurs. Which statements describe how natural selection work
vekshin1

Answer:A and D

Explanation: Because that’s what US Test Prep said was right.

6 0
3 years ago
Other questions:
  • Other than improvements in hygiene, give two reasons for the low death rate from infectious diseases in modern hospitals.
    13·1 answer
  • Which two sentences support only the heliocentric model of the solar system and not the geocentric model?
    15·1 answer
  • What does phontosynthesis really means?
    13·2 answers
  • A lizard lies on a rock to raise its body temperature what is this called?
    15·2 answers
  • What type of TV uses a CCFL for backlighting?
    8·2 answers
  • Why did the population of deer increase during the wolves absence?
    11·1 answer
  • 2 Points
    15·1 answer
  • What helped stop the spread Islam in southern Africa
    8·1 answer
  • The range of motion as well as the direction of motion for the various regions of the spine differs. For example the lumbar spin
    7·1 answer
  • The image shows Isotherms on a map.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!