1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hammer [34]
3 years ago
8

Many fish use the way they look to communicate. What feature makes the queen angelfish in the picture easy for other queen angel

fish to find?
A.
large sharp teeth
B.
very small fins
C.
brightly colored scales
D.
a short thin body
Biology
1 answer:
podryga [215]3 years ago
4 0

Answer:

i think it’s C

Explanation:

You might be interested in
Pls helpppp and thank youuuu
Elena L [17]
I think the answer is C, it’s helps
4 0
3 years ago
Stem cells have the ability to divide through what
sdas [7]

Embryonic stem cells. These stem cells come from embryos that are three to five days old. At this stage, an embryo is called a blastocyst and has about 150 cells. These are pluripotent (ploo-RIP-uh-tunt) stem cells, meaning they can divide into more stem cells or can become any type of cell in the body.

5 0
3 years ago
Which nonspecific defense mechanism increases the resistance of cells to viral infection and slows the spread of disease?​
satela [25.4K]

Answer:

Which nonspecific defense mechanism increases the resistance of cells to viral infection and slows the spread of disease?​

the nonspecific defense mechanism that increases the resistance of cells to viral infection and slows the spread of disease is called phagocytic barrier

Explanation:

Phagocytic barrier helps to attack any foreign materials that enteiers the body system sych as bacteria, viruses among others.

5 0
3 years ago
Explain several ways water is stored during the water cycle.
sergij07 [2.7K]

Answer:

The water cycle

Explanation:

<em>Possible answers include that water is stored as ice and snow on the ground during the water cycle. Water is also stored in clouds until precipitation occurs, which transfers water from the atmosphere to the ground. On the Earth's surface, water can be stored in liquid form in streams, rivers, lakes, and oceans.</em>

7 0
4 years ago
Read 2 more answers
An ecosystem receives plenty of rainfall, ending a drought which decreases the number of limiting factors in the ecosystem. What
Marysya12 [62]

Biodiversity will decrease because it just will.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Why are platypus,brown bear,lion,and house cat thought to be related to each other?
    7·1 answer
  • What do microbes eat
    10·2 answers
  • The short/ rod-shaped bacteria that produces tetanus, typhoid fever, tuberculosis, and diphtheria is known as ____
    12·1 answer
  • Please help I need a A
    15·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • What is air pollution? Distinguish between primary pollutants and secondary pollutants and give an example of each. List the maj
    6·2 answers
  • How is a mitochondria’s structure related to its function
    13·1 answer
  • A women brings her 5 year-old nephew to you for evaluation of a wart. You feel there are 2 therapeutic options; treat the wart w
    6·1 answer
  • (FW.02]The diagram below shows a portion of the water cyle.
    13·1 answer
  • Analyze the data from Data Table 2. As the mass of an object doubles, its kinetic energy
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!