1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorLugansk [536]
2 years ago
9

Help pls, I rlly need it?

Biology
1 answer:
jok3333 [9.3K]2 years ago
6 0

Answer:

maybe a 3-D model or a 2-D

You might be interested in
The _____ of a food describes the extent to which the body is able to absorb the nutrients from the food and use them. bioavaila
rjkz [21]
The correct answer is bioavailability.
<span>Bioavailability is an important factor in establishing nutrient requirements and it represents the degree to which food nutrients are available for absorption and utilization in the body. The amount of a nutrient in a food that the body can actually use may vary depending on age and physiologic condition.</span>
4 0
3 years ago
In areas where kelp is abundant, sea urchins can be found. If sea otters live in the same ecosystem as the sea urchins, the equi
Alexxandr [17]

Answer:

There needs to be enough sea urchins for otters to come and there needs to be enough otters to eat the urchins.

Explanation:

5 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
how do you living and nonliving things interact with each other? how might the function of an ecosystem be affected if living an
MrMuchimi

Answer:

Some examples of living things are organisms such as plants, animals, fungi, and bacteria. Organisms interact with the living and nonliving things in their ecosystem to survive. ... These living things interact with the nonliving things around them such as sunlight, temperature, water, and soil

7 0
3 years ago
In what two ways did the Soviets stray from the ideas about communism advanced by Karl Marx?
nikitadnepr [17]

Answer:

By not giving powers to workers.

Explanation:

  • They added other ideas to this body of the argument, Marx said that industrial society was capitalist.
  • He was more concerned that workers would triumph in their conflict was capitalists.
  • This would be a communist society, it was the natural society of the future.
  • Marx believes that to free themselves from the exploitation of capitalist, workers had to create a radical socialist society where all property was socially managed.

6 0
3 years ago
Other questions:
  • Red-green color blindness is a recessively inherited disorder that affects 7% of the male population but only 0.4% of the female
    7·1 answer
  • What are the levels of organization
    10·1 answer
  • What is gene and what is its function in body?
    7·1 answer
  • What part of the map tells you what type of map this is?
    8·1 answer
  • Obtain a copy of the Student Guide for this lab. Your teacher may provide a copy, or you can click the link to access it. Be sur
    11·2 answers
  • Which scenario transforms<br> normal cells into<br> cancer cell
    13·1 answer
  • The latest data on adult participation in physical activity reveals that ____________
    11·1 answer
  • In the electron transport chain of the mitochondria, electrons are commonly
    13·1 answer
  • Which phrases describe a metamorphic rock
    12·2 answers
  • PLS HELP ME WILL GIVE 100 PONITS: construct an argument that plants have internal and external structures that
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!