1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
White raven [17]
3 years ago
11

Compare what ways are planets and dwarf planets similar.

Biology
1 answer:
Cerrena [4.2K]3 years ago
3 0
So the similarity of the planets and the dwarf planets are they are both mostly round because they have sufficient gravity to flatten their own surfaces into a sphere. The differences are that planets are big enough to clear the whole region of space where they orbit the sun whereas dwarf planets do not.
You might be interested in
Why is it important to get enough protein in
drek231 [11]
Because you got to eat enough protein so you don’t end up in the hospital
7 0
3 years ago
Read 2 more answers
What does the phrase "Aspiring designers mean? HELP PLZ!!​
anzhelika [568]

To have a great ambition or ultimate goal; desire strongly

8 0
2 years ago
Why in sexual reproduction do we use different cells from meiosis and not identical cells from mitosis?
Ganezh [65]

Answer:

Still need help?

Explanation:

3 0
3 years ago
What method of gene regulation or gene expression is the most common for eukaryotic
castortr0y [4]

Answer:

Transcription factors

Explanation:

This is because Eukaryotic gene expression is regulated by transcription factors and RNA processing, which occur in the nucleus, and during protein translation, in the cytoplasm.

Transcription in eukaryotic cells is controlled by proteins . These proteins then bind to some specific regulatory sequences and try to control the activity of RNA polymerase. The Gene expression is regulate by transcriptional regulatory proteins . Also ,the packaging of DNA into chromatin and methylatiin indicate levels of complexity to the control of eukaryotic gene expression.

5 0
2 years ago
Electric Charge. options: Radiation Discovery Kinetic Energy Electricity
Shalnov [3]

Electric Charge. options:

Radiation

Discovery

Kinetic Energy

<u>Electricity</u>

4 0
3 years ago
Read 2 more answers
Other questions:
  • Select all that apply.
    8·2 answers
  • A client is having a level 2 ultrasound. a nurse knows that physicians order this procedure:
    7·1 answer
  • How does administration of nitroglycerin help someone that might be suffering from a myocardial infarction?
    5·1 answer
  • What phenotype would you expect from a cross between a Red Bull and a white cow
    9·1 answer
  • Bile is formed by
    11·2 answers
  • Over the last several decades, what have researchers discovered about atmospheric CO2 levels?1 They have decreased.2 They have i
    6·1 answer
  • Which of these bests explains the difference between the way animals and plants exchange gases with their environments?
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • 2. What are the forces of nature that affect your life on a daily/monthly/seasonal<br> basis?
    13·1 answer
  • Identify three ways flowering plants can be adapted to<br> different environments. (PLEASE HELP!!)
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!