1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allsm [11]
3 years ago
8

The thin external covering is similar to the

Biology
1 answer:
Neporo4naja [7]3 years ago
4 0

Answer:

The thin external covering is similar to the Cell Membrane. The organelle with a texture like sandpaper is the rough endoplasmic reticulum (ER)

You might be interested in
Lesson of the kaibab
fenix001 [56]
Hey, mind putting the question in the replies so I can answer this? Thanks.
7 0
3 years ago
Read 2 more answers
An atom contains
Karo-lina-s [1.5K]

Answer:

e. equal numbers of protons and neutrons in the nucleus orbited by varying numbers of electrons

Explanation:

7 0
3 years ago
What does soil have to do with climate change ?
Troyanec [42]

Answer:

Las montañas generan sombre y brisa, mientras que que en una pradera que es casi llano el calor se acumula en el suelo pero el problema es la de forestación que provoca que las arboles que actuaban como las montañas dañen el entorno secando el fresco y húmedo suelo causando problemas con el ambiente

7 0
3 years ago
Which of these best explains why Earth’s tectonic plates move?
Andrei [34K]

Answer:

Its A

Explanation:

8 0
3 years ago
What is an effect of La Niña?
grigory [225]
D. because it causes dry conditions
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these layers is typically thinnest?
    11·2 answers
  • Which organisms would you like to sing with
    14·2 answers
  • Explain what limiting factors are and how they influence the productivity of an ecosystem.
    7·1 answer
  • What is a environmental variable that effect wing color
    8·2 answers
  • The waxy protective covering of landing plant is called
    9·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Which statement is correct about rough ER and smooth ER?
    12·1 answer
  • Which land features are most likely found near a convergent plate boundary?
    15·1 answer
  • Which of the following best describes the physical structure of a gene?
    7·1 answer
  • Which functional group typically has a negative charge at the ph of the cell?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!