1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
brilliants [131]
3 years ago
13

What is the economic important of butterfly and sugar ant​

Biology
1 answer:
ololo11 [35]3 years ago
8 0

Explanation:

Butterflies are central pollinators to many agricultural crops, their ecological function is also a food source to predators like birds, spiders, lizards and other animals. Butterfly's beauty is like a flower, which displays attraction wherever it flies.

Sugar ants prefer honeydew from aphids and protect aphids from other predators to ensure the safety of their food source. These insects also feed on: Nectar and also Plant-eating invertebrates such as caterpillars.

You might be interested in
Help please?
MatroZZZ [7]

1. The right answer is AC (alternative current) generators.

AC current (which can be abbreviated as AC) is a periodic electrical current that changes direction twice per period and carries alternating amounts of electricity in one direction and the other1. An alternating current therefore has a continuous component (average value) zero.


2. The right answer is Repel, and attract.

The nucleus of an atom is an assembly of protons and neutrons concentrated in a very small volume and subjected to two different forces: the nuclear force and the electric force.

The electric force only acts on charged particles, attracting those which are of opposite signs and repelling those of the same sign. This "long" distance force allows the negatively charged electrons to be retained around the positively charged nucleus.


3. The right answer is electric circuit

An electrical circuit in the material sense is a simple or complex set of electrical or electronic components, including simple conductors, traversed by an electric current.

In the sense of circuit theory, an electrical circuit is an abstraction of material configurations, an arrangement of elements defined by mathematical relations, connected by ideal conductors.


4. The right answer is Volts and current.

Volt (V) is the unit of measurement of the electrical voltage in a circuit between a point A and a point B, obtained with a device called a voltmeter. It is to Alessandro Volta, Italian physicist and inventor of the electric battery, that we owe this name.

The ampere (A) is the unit of measurement of the intensity of an electric current, that is to say the flow of electrons in a conductor. André-Marie Ampère, the inventor of the electromagnet, gave his name to this unit.


5. The right answer is north pole.

The magnetic North Pole of the Earth is a unique wandering point on the surface where the Earth's magnetic field is pointing down. That is, the "dip"  is 90 °. The needle of a compass points approximately towards this place (more or less approximately according to the place where one is, exactly the compass is tangent to the line of field).


6. The right answer is perpendicular.

In a cyclotron, the magnetic field is applied perpendicularly in an empty disk-shaped chamber, which contains two D-shaped semicircular electrodes. The rectilinear portions of these electrodes face each other. The flow of electrons or ions crossing a perpendicular magnetic field is subjected to a forceperpendicular to the direction of movement.


7. The right answer is current

A solenoid is a device consisting of an electric wire wound regularly in a spiral so as to form a long coil. Running through a current, the solenoid produces a magnetic field in its vicinity, and more particularly inside the helix where this field is almost uniform.

8 0
3 years ago
Read 2 more answers
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
If a disease strikes the snake population in the food chain shown, what will be the initial effect on the populations of hawks a
Alecsey [184]
The answer is B. The hawks no longer have competition and the rabbits have one less predator.
8 0
3 years ago
Help me with this please i will give 20 points because this is a lot
Colt1911 [192]

Answer:

causes a cell to change: hypotonic,hypertonic

doesnt change the shape of the cell: isotonic

I dont know what the 3rd one is

Causes a cell to shrink:Hypertonic

Explanation:

7 0
3 years ago
HELPPP WHAT ARE Three ways nitrogen can be fixed or transformed for animals and plants to use? WHOEVER ANSWERS WILL GRT MARKED B
sdas [7]
Nitrogen fixation is the process by which nitrogen gas from the atmosphere is converted into different compounds that can be used by plants and animals. There are three major ways in which this happens: first, by lightning; second, by industrial methods; finally, by bacteria living in the soil.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Summarize the primary stages of the cell cycle
    13·1 answer
  • What is the difference between covalent and iconic bonding's
    6·2 answers
  • What is the best reason for assessing a neonate weighing 1,500 g at 32 weeks’ gestation for retinopathy of prematurity (ROP)?
    12·1 answer
  • Some students want to test different soils to find out which ones absorb heat the fastest. For the first test, they put 500 gram
    10·1 answer
  • A mutation in human ATPase 6, which corresponds to E. coli subunit a, from leucine to arginine at position 156 may allow the mov
    6·1 answer
  • plzzz help I'm in a test i only got 30 mins left plz hurry read directions 1.Give examples of EACH of the following ways that we
    15·1 answer
  • Jake broke his fibula and had to wear a cast for six weeks. The muscles attaching to this bone atrophied (shrank) during this ti
    11·1 answer
  • Easy way to remember color of spectrum (not the richard of york one plz)
    11·2 answers
  • 6. Adolescent females often require additional amounts of iron in their diet. Explain why.
    14·1 answer
  • What does a plant or animal need in order to survive in a certain ecosystem?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!