1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jek_recluse [69]
3 years ago
11

Which bond is the strongest ion, hydrogen, or covalent

Biology
1 answer:
Black_prince [1.1K]3 years ago
4 0

Answer:

Ion

Explanation:

Covalent bonds are stronger than hydrogen bonds. Ionic bonds are stronger than covalent bonds because of the coulombic attraction between ions of opposite charges.

You might be interested in
Sara is waiting for the result of the blood sugar test she took at a doctor's clinic. she is very anxious and worried. sara's an
Hoochie [10]
It is an example of uneasiness. It is because being anxious is a way of having to be worried to a specific thing or problem in which when a particular person is worried, he or she is likely feeling anxious as he or she seeks for something that will relieve his or her worries.
7 0
3 years ago
Read 2 more answers
"refined carbohydrates are digested __________, leading to a ________ rise in blood glucose levels."
Sedaia [141]
Refined carbohydrates are digested faster, leading to a fast rise in blood glucose levels.

Refined carbohydrates have a higher glycemic index than processed whole grains. That's because of their simple chemical structure, leading to powerful spikes in blood sugar and insulin secretion. This immediate impact can lead to an increased risk for type 2 diabetes, overweight and heart disease.






3 0
3 years ago
When do electrons form an electrical current?
irina1246 [14]
D. think of it like a current!

electron -> electron-> electron->
4 0
2 years ago
Read 2 more answers
When you talk together in a group during a laboratory exercise, you are engaging in public scientific communication. classroom s
egoroff_w [7]

Answer:

Option number 2 is correct. When you talk together in a group during a laboratory exercise, you are engaging in classroom scientific communication.

Explanation:

Any type of communication that is made regarding science is described as a scientific communication. This kind of communication generally involves talks about research, recent advances in any scientific topics or techniques, observations that one might have made on a particular science topic, asking another person about any science-related topic or techniques, etc.

If a scientist talks about any science topic to the public, then it would be a public scientific communication. A scientific communication made among scientists would be termed as professional scientific communication. Any science based communication that is made and kept private would be termed as private scientific communication.

Hence, option 2 is correct. A science based communication between students in a lab would be classroom scientific communication.

6 0
3 years ago
Read 2 more answers
A student was observing slides of cell division. In one of the slides, he noticed loosely coiled chromatin depicting DNA duplica
tatuchka [14]

The correct answer is:

S phase

Explanation:

S phase (synthesis phase) is the part of the cell cycle in which DNA is replicated, occurring between G1 phase and G2 phase. Accurate and accurate DNA replication is needed to counter genetic exceptions which often lead to cell death or disease. DNA replication occurs during this S (synthesis) phase. Gap 2 (G2): During the gap between DNA structure and mitosis, the cell will remain to grow and design new proteins.

5 0
3 years ago
Read 2 more answers
Other questions:
  • To protect biodiversity worldwide, many conservationists suggest that at least 10 percent of Earth's land be set aside as protec
    6·1 answer
  • Jane is interested in studying how physical aspects of the environment interact with the environment’s chemical processes. Which
    6·2 answers
  • Which best describes the current trend of earths warming?
    8·1 answer
  • Two kittens are sleeping by a furnace vent. they are relying mainly on what kind of heat transfer?
    14·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Where does translation occur in the cell?
    14·1 answer
  • Fats that contain ____ double bonds are liquids at room temperature, whereas fats that contain ____ double bonds are solids at r
    6·1 answer
  • (GIVING BRAINLIEST!!)
    5·1 answer
  • please help ill give brainliest :)) A car travels a distance of 385 km in 8 hours. At what speed did it travel?
    8·2 answers
  • Section II: Data and Analysis
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!