During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
the black plague took a toll no the population back then and claimed alot of lives
Answer:
analogous
Explanation:
both a bats wing and a butterfly wing are there for the same reason, but they are not composed the same
The answer is B.
These elements are among the most important elements in life. Most of these elements are also non-metals. Elements life sulfur and nitrogen combine with carbohydrates to form among acids rings like cysteine. Carbohydrates combine with phosphorus to form molecules such as the DNA backbone chain.
