There is an irruption
Lava gets cooled with water (lake)
It turns to magma
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
Aerobic respiration takes place in the mitochondria and requires oxygen and glucose, and produces carbon dioxide, water, and energy. ... Anaerobic respiration also produces energy and uses glucose, but it produces less energy and does not require oxygen.
Explanation:
Answer:
basically Peristalsis is the involuntary constriction and relaxation of the muscles of the intestine or another canal, creating wavelike movements that push the contents of the canal forward.
it occurs in esophagus, stomach, intestines.
Answer:
DNA helicase
Explanation:
DNA helicase unwinds the DNA strands by breaking the hydrogen bonds down at the center of the strand. this process begins in the replication fork of the DNA strand
