1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Akimi4 [234]
3 years ago
10

Which procedure is an example of classifying observed data?

Biology
2 answers:
Vitek1552 [10]3 years ago
6 0
A is the correct answer
Len [333]3 years ago
5 0

Answer:

A

Explanation:

C is just gathering data and observations

D doesn't classify anything

B isn't classifying anything it's just measuring data

You might be interested in
Wrong, its the electron transport chain
PilotLPTM [1.2K]
Not a question. Please refrain from unnecessary post.
8 0
3 years ago
Which animal has blue blood ??​
ValentinkaMS [17]

Answer:

spiders

Explanation:

While humans and many other species have red blood, due to the iron in their hemoglobin, other animals have different colored blood. Spiders(as well as horseshoe crabs and certain other arthropods) have blue blood due to the presence of copper-based hemocyanin in their blood. Some animals, such as the sea cucumbers, even have yellow blood.

8 0
3 years ago
Read 2 more answers
Birth control pills contain a combination of estrogen and progesterone that signal the pituitary gland to not release follicle-s
zloy xaker [14]

Answer:

True.  

Birth control pills contain a combination of hormones that prevent the formation of the ovule, by prevent the formation of the luteinizing follicle.  There are several types of birth control pills,but the process is generally the same

Explanation:

6 0
3 years ago
Make a claim about the types of wastes that the excretory system removes. Support your claim with evidence and explain your reas
artcher [175]

Answer:

Explanation:

Urea is the cellular waste product that the kidneys remove from the blood.Kidneys are the two bean shaped organs that has several functions to keep the body healthy. It not only removes urea from the blood, but also helps in the formation of urine and maintaining the fluid level of the body. The two kidneys are placed on the two sides of the spinal cord. The blood enters the kidney through the renal artery. The nephron within the kidneys mainly take out the waste products and the excess water from the blood and purifies it.If the kidneys of a person fail to work properly then it becomes important to perform dialysis for taking out the waste materials from the blood.

3 0
3 years ago
Secondary metabolites
mariarad [96]

Answ........

............

8 0
3 years ago
Other questions:
  • An area with several universities might be called
    15·1 answer
  • How man tails does an octopus have?
    10·2 answers
  • Which exercise would the nurse suggest as most helpful to maintain mobility in a child with juvenile idiopathic arthritis?
    15·1 answer
  • How much kidney filtrate is reabsorbed back into the vascular system?
    8·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The flower color in this plant is inherited by incomplete dominance. if a red flower that is homozygous dominant is crossed with
    6·1 answer
  • Quien es el solvente
    9·1 answer
  • Predict the genotype of the missing parent <br> A. xy<br> B. xx<br> C.YY<br> D.XY
    5·1 answer
  • The two basic ways transport can occur are passive and diffusion true or false
    8·1 answer
  • She notices that the muscle cells are loaded with mitochondria while the macrophages have abundant lysosomes. why is this so?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!