1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
3 years ago
10

MULTIPLE CHOICE!!

Biology
1 answer:
Svetlanka [38]3 years ago
7 0
He could use the property of capillary action of water ta dye white flowers hot pink
You might be interested in
4. Lily is studying the core of Earth. Which sphere is she examining?
erastovalidia [21]
Lithosphere is the anwser
5 0
3 years ago
Read 2 more answers
The energy animals need for their life functions is released when their cells carry out which of the following functions
Vlad [161]

Cellular respiration

Explanation:

The energy animals need for their life functions are released when their cells carry out cellular respiration.

Cellular respiration is a metabolic process by which living organisms breaks down organic molecules using oxygen  especially glucose to produce energy and gives off carbon dioxide and water in the process.

It is the reverse of photosynthesis.

During this process, chemical energy stored in food substances are released and converted to heat energy.

The process takes place in the mitochondria of a cell.

learn more:

Respiration brainly.com/question/5895241

#learnwithBrainly

5 0
3 years ago
suppose you water a potted plant in place at by a window in a transparent airtight jar predict how the rate of photosynthesis mi
Minchanka [31]
Because it has the ability to get light, photosynthesis would happen. Since it is in an airtight jar, it will use all the CO2 in the jar until all the CO2 is gone and there is only Oxygen left. Photosynthesis's rate will decrease rapidly. After that, the plant will have no more energy since there is no CO2 to allow it to keep with photosynthesis, so it would die off. 
6 0
3 years ago
Read 2 more answers
Which is the correct order in the scientific process
solmaris [256]
1

state the problem

<span></span>2

hypothess (prediction)

<span></span>3

design the experiment

<span></span>4

record and analyze the date

<span></span>5

<span>conclusion (what did you learn)</span>

7 0
4 years ago
Read 2 more answers
What 3 ways do science influence society
Romashka-Z-Leto [24]
<span>It has influence on many things like economy, industry, transport and so on.

</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • What did you observe when you mechanically stimulated your retina? what you learned from lecture explains the observation?
    12·1 answer
  • What does it mean to analyze data?
    12·1 answer
  • Which phase of meiosis occurs right after crossing over takes place
    6·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The scientific theory that describes the beginning of the Universe is called the
    15·2 answers
  • Question 1 of 5
    11·1 answer
  • Explain how the shape of a finch's beak is an example of an adaptation?
    7·1 answer
  • Describe the process by which vaccines induce immunity.
    15·1 answer
  • ANSWER ASAP: Dead zones are caused largely by the input of agricultural fertilizers that stimulate phytoplankton blooms, which d
    15·1 answer
  • What materials make up the cell membrane
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!