1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
salantis [7]
3 years ago
8

How biosphere affects the flow of matter and energy on Earth

Biology
1 answer:
Brrunno [24]3 years ago
7 0

Answer:

Energy enters the biosphere as sunlight.Plants change this energy into chemical energy through the process of photosynthesis. Then, the energy is passed to organisms that eat the plants. Energy and matter is also passed between organisms when they eat one another.

You might be interested in
In the skeletal muscle cells of vertebrates, as many as ____________ molecules of atp are produced from one molecule of glucose.
shusha [124]
<span>In the skeletal muscle cells of vertebrates, as many as 38 molecules of ATP are produced from one molecule of glucose. This is less than might be expected, because electrons from NADH produced during glycolysis must be shuttled through the inner mitochondrial membrane at a cost.
</span>The energy of the electrons can be used to make ATP and in eukaryotes, glycolysis occurs in the <span>cytosol, outside mitochondria. </span>
5 0
4 years ago
Read 2 more answers
I need some help with this fill in the blanks, picture is above ^ Thanks.
artcher [175]

Answer:

haploid diploid half sex reduction

Explanation:

4 0
3 years ago
The Venus fly trap is a plant that has a unique system by which the traps and breaks down its prey unsuspecting a insects in lan
LenaWriter [7]

Answer:

so... whats the question?

Explanation:

8 0
3 years ago
Read 2 more answers
Select all of the answers that apply. The Sun emits a lot of radiation. The different types of radiation are the electromagnetic
beks73 [17]
<span>radio waves, microwaves, gamma rays, X-rays, visible rays

Hope this helps</span>
3 0
3 years ago
Read 2 more answers
Segment of chromosome is placed in the reverse order.
Kitty [74]

Answer: Inversion

Explanation:

3 0
3 years ago
Other questions:
  • What are the terms used to describe the movement of air into and out of the lungs?
    13·1 answer
  • _______ are RNA and protein complexes that are found in all cells. These complexes help cells during protein translation by join
    7·2 answers
  • How does exhaling remove waste from the body? Explain the systems that make this happen, using complete sentences.
    11·2 answers
  • A chemical mutagen that is structurally similar to a nucleotide but has different base-pairing rules is called a ________.
    10·1 answer
  • Sort the properties to describe each of the three domains. Some of the properties may be used more than once.
    10·1 answer
  • Deforestation of rainforests would most likely affect such plants by causing
    14·1 answer
  • What is the Complementary strand? <br> Original: UACUCAGGUUCA<br> Complementary strand:
    14·1 answer
  • What enzyme has more specificity: if the constant of Michaelis-Menten is higher or if it's lower?
    9·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • You can think of DNA as a great library of information that exists to do one thing only. What is that thing?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!