1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
2 years ago
10

Which of the following is (are) NOT a function of the sodium/potassium pump?

Biology
1 answer:
salantis [7]2 years ago
7 0
C…………………. ……………xxxxxxxxiiugfvvbbh
You might be interested in
What's an Animal ring?
Likurg_2 [28]
Some animal cells, such as amphibian eggs, never have a complete ring, but form a spreading arc

! I don’t know if that’s what you’re talking about !
7 0
3 years ago
Dichotomous keys and branching diagrams organize different types of information about classification. How are these tools used d
Ivenika [448]
<span>In a dichotomous key you named them by their traits while in a branching diagram it already has the name and it's traits.

</span><span>
Hope this helps :)</span>
4 0
3 years ago
Cross a plant that is heterozygous for green pods with a plant that has yellow pods
saw5 [17]
G=Green....because your starting plant is heterozygous it must be Gg
g = yellow ....because yellow is recessive, it must be gg

Gg x gg 

Do a Punnet Square and you get
Gg (2)
gg (2)
So half of your plants will be green (but heterozygous) and half will be yellow (homozygous)
5 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
The outcome of protein synthesis is ______.
Rudik [331]

Answer:

C. A protein

Explanation:

The outcome of protein synthesis is <u>a protein.</u>

5 0
2 years ago
Read 2 more answers
Other questions:
  • Why is weathering of the lithosphere important for the atmosphere?
    13·1 answer
  • The A and B antigens in humans may be found in water-soluble form in secretions, including saliva, of some individuals (Se/Se an
    9·1 answer
  • In Liepmann's theory of left-hand apraxia, the MOST likely location of the lesion would be:
    5·1 answer
  • Why do you think the size of a white dwarf affects its visual luminosity?
    9·1 answer
  • Reactions in cells are generally regulated by regulating the activity of the enzyme that catalyzes that reaction. Broadly speaki
    10·1 answer
  • What determines the damage caused to the human body by an electric shock
    5·1 answer
  • Can you help me with this
    7·2 answers
  • What two main factors would best indicate the quality of life of a country's 1 point
    6·1 answer
  • Some species can reproduce sexually or asexually. In which two situations is sexual reproduction advantageous?
    5·2 answers
  • What type of molecule is doing the "work" in the picture
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!