1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali5045456 [20]
2 years ago
8

Explain how Earth's magnetic field is generated.

Biology
2 answers:
pychu [463]2 years ago
8 0

Answer:

On Earth, flowing of liquid metal in the outer core of the planet generates electric currents. The rotation of Earth on its axis causes these electric currents to form a magnetic field which extends around the planet

luda_lava [24]2 years ago
4 0

Answer:

<em>The magnetic field is generated by electric currents due to the motion of convection currents of a mixture of molten iron and nickel in the Earth's outer core: these convection currents are caused by heat escaping from the core, a natural process called a geodynamo.</em>

You might be interested in
Where do producers get matter and energy to live and grow ?
Mkey [24]

Answer:

B is your answer!

Explanation:

5 0
3 years ago
Read 2 more answers
Which of these sets of features is common among embryos of four-legged vertebrates?
Gelneren [198K]
There is no picture so I can’t get it
7 0
2 years ago
Thale cress is a plant that is genetically engineered with genes that break down toxic materials. Which type of organism is desc
MArishka [77]
The correct answer for the given question above would be option B. Thale cress <span>is a plant that is genetically engineered with genes that break down toxic materials, so this would be a transgenic type of organism. By definition, transgenic organisms undergone genetic engineering wherein genes of a particular specie is modified or transplanted into another. Hope this helps.</span>
5 0
2 years ago
Read 2 more answers
White-tailed deer eat green plants, acorns, fruits, nuts, and twigs.
Ainat [17]

Answer:herbivore

Explanation: herbivores don’t eat meat and they are prey so the deer is also low on the food chain.

4 0
2 years ago
Read 2 more answers
Name four macromolecules present in all living things and identify what they have in common.
kondaur [170]
<span> - </span><span>A typical meal contains </span>all four<span> types of </span>macromolecules<span>. </span>Living things<span> are made of </span>four<span>types of molecules, known as </span>macromolecules<span>: ... Highly specialized at what </span>they<span> do, proteins form both the railways and the motors that ... it exists as a single strand and </span>has<span> a special building block not</span>found<span> in DNA.</span>
5 0
2 years ago
Read 2 more answers
Other questions:
  • In the food chain, the grasshopper would be classified as a?
    15·2 answers
  • How does the location of a biome impact the climate?
    5·1 answer
  • Which joint has the greatest range of motion?
    15·1 answer
  • What percentage of energy is transferred when a mouse is eaten by a fox? 90% 0% 10% 100%
    14·1 answer
  • Anyone know #1? Thanks!
    15·1 answer
  • How do you find quotation 
    7·1 answer
  • The vast species diversity in rain forests indicates that these forests _____.
    8·1 answer
  • Create a sentence explaining how amino acids form proteins
    14·2 answers
  • why do you think a significant portion of the U.S. population today still doubts evolution, despite all of the evidence?
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!