1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paladinen [302]
2 years ago
13

specifies which people in a sport organization are required to report suspected child abuse to law enforcement.

Law
1 answer:
vazorg [7]2 years ago
3 0

Answer: any mandetory reporter can report about such cases. defintion of mandetory reporter includes following types of personnel.

1. any adult authorized by a national governing body or member of a governing body.

2. any amateur sports organization that participates in interstate.

3. international amateur athletic competition, to interact with a minor or amateur athlete at an amateur sports organization facility or at any event sanctioned by a national governing body.

4. a member of a national governing body, or such an amateur sports organization.

                                                                                ----US club soccer----                                                        

Explanation:

find out more on :

https://usclubsoccer.org/safesport/

You might be interested in
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
In 1968, the Law Enforcement Assistance Administration was created and was responsible for administering the
Andrei [34K]

Established in 1968, the LEAA was set up within the U.S Department of Justice to allocate money to improve the efficiency and effectiveness of the criminal justice system. Between 1968 and 1977, the LEAA spent more than $6 billion on crime control programs and college education for police officers

  • As it were 1 percent of neighborhood law requirements organizations require a four-year degree, and 75 percent have no formal approach connecting instruction with advancement.
  • We contend that a four-year degree standard has not been embraced since police organizations and police work have not changed in ways that require it.
  • We do address presumptions that higher instruction is basic to police polished skill, which a four-year degree makes strides in execution.
  • Encouragement, we attest that police preparation and instruction are similar endeavors in which a more full integration is needed. We conclude with proposals to extend participation between the criminal equity workforce and police directors.

Correct question: In 1968, the Law Enforcement Assistance Administration was created and was responsible for administering higher education opportunities for law enforcement professionals.

To know more about LEAA visit: https://brainly.in/question/32686119

#SPJ9

4 0
1 year ago
“Does the advantages (pros) of the 2nd Amendment outweigh the disadvantages (cons)?
Charra [1.4K]

Answer:

the advantages don´t outweigh the disadvantages.

Explanation:

This is because their are more disadvantages then there are advantages. The disadvantages are that the law is not that strict. Anyone can get a gun. And its fairly easy. Someone can go to a gun shop and say that they collect all types of guns and they don´t need any prof of type of licence.

8 0
2 years ago
The type of Congress established in Article 1, Section 1 of the US Constitution, is
yulyashka [42]
Bicameral because of the two houses currently in congress
6 0
3 years ago
Question 1 (2 points)
son4ous [18]

Answer:

Ethics are static

Explanation:

Ethics may change due to experiences that happen later in life or by other influences.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Fatal injuries and structural failure will occur from explosions with a blast pressure of
    10·1 answer
  • The preservationists were nature-oriented and were less concerned with human need and consumption.
    6·1 answer
  • On single lane roads, _____ before taking a blind curve.
    6·2 answers
  • how does the supreme court use tests? what test does the court use when determining whether a state can use a confession obtaine
    14·1 answer
  • How is the role of a prison guard relevant to the court and judicial process?
    6·2 answers
  • A type of antisocial behavior is stalking. It generally involves the following behaviors except:
    13·1 answer
  • Ethics refers to the understanding of what constitutes good or bad behavior and help to guide our behaviors.
    15·1 answer
  • How does a cooperative help social change?
    12·2 answers
  • Residents in Georgia pay a sales tax when they
    8·2 answers
  • _____ means that laws must be applied fairly and equally to all people, especially to a citizen accused of a crime.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!