1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
2 years ago
8

The question is in the picture

Biology
1 answer:
const2013 [10]2 years ago
5 0

Answer:

protein specifically an amino acid

You might be interested in
The two lower leg bones are called the _____ and the _____.
Ad libitum [116K]
The two lower leg bones are called the tibia and the fibula
8 0
2 years ago
Read 2 more answers
Diferencia entre estimulo y receptor
Archy [21]

Explanation:

Un estimulo es cualquier cambio que es capaz de producir una respuesta por parte del organismo. Los receptores son estructuras muy especializadas capaces de percibir los estímulos y convertirlos en impulsos nerviosos

7 0
3 years ago
An experiment is designed to test what color of light will activate a photoelectric cell the best. The photocell is set in a cir
OleMash [197]

Answer:

The filter is the independent variable--the one that is intentionally varied.  The click rate depends upon the filter selected

hope this helps :)

8 0
3 years ago
Which event might disrupt a stable ecosystem?
mel-nik [20]
An invasive species.
7 0
3 years ago
Read 2 more answers
Which system controls the female reproduction system?​
CaHeK987 [17]

Answer:

i would think its the nervous system

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is the final thing you would do if you were applying the scientific method
    8·2 answers
  • What molecules go into the calvin cycleee
    14·1 answer
  • Which of the following hormone and cardiovascular effect is NOT correctly matched?
    6·1 answer
  • Segmented animals are ____ symmetrical. Their bodies are divided into repeating parts, or segments. Typically, some of their bod
    6·2 answers
  • 5 Points
    12·2 answers
  • Which words or phrases describe slate? Check all that apply.
    12·1 answer
  • Cells that do not contain nuclei are known as
    12·1 answer
  • Suppose the great, green galoofus lizard has 28 chromosomes in the nucleus of its unfertilized eggs. Predict how many chromosome
    11·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Which event causes tides? O the blowing of the wind O the movement of warm and cool water O the interaction of the moon, the Sun
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!