1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DaniilM [7]
3 years ago
6

What is the difference between the high cho and the control group?

Biology
1 answer:
notka56 [123]3 years ago
5 0

Answer:

Carbohydrate intake before trial.

Explanation:

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Minerals form from magma in predictable patterns in a process known as
rusak2 [61]
The word you're looking for is the Bowen's reaction.

Hope it helped!
3 0
3 years ago
What is the job of vacuoles in animal cells? Explain.<br><br> Thank you :)
natka813 [3]

Answer:

Vacuole. A vacuole is a membrane-bound cell organelle. In animal cells, vacuoles are generally small and help sequester waste products. In plant cells, vacuoles help maintain water balance.

Explanation:

7 0
4 years ago
Read 2 more answers
What would happen to a plant if watered with salt water?
Orlov [11]
If<span> you </span>water<span> a </span>plant<span> with </span>salt water<span>, it will wilt, and will eventually die. This is due to the fact that the </span>salt water<span> is a hypertonic solution when compared to the </span>plant<span> cells, and </span>water<span> inside the </span>plant<span> cells will diffuse by osmosis out of the cells in order to reduce the concentration of the </span>salt<span> solution.</span>
3 0
3 years ago
?the _____ lobe is behind the frontal lobe and is separated from it by the central sulcus.
julia-pushkina [17]
The frontlobe is behind the frontal lobe and is separated from it by the central sulcus.
4 0
3 years ago
Other questions:
  • A population that increases 5 percent every year is said to be experiencing
    11·1 answer
  • I need help with this biology on the behavior of light.!​
    8·2 answers
  • A pack of dog is considered which level of bioligical organization
    6·1 answer
  • What are four different properties of magnets
    7·2 answers
  • I only need number 5. Pls help. It shouldn’t take long
    11·2 answers
  • Which of the following statements does NOT accurately describe difference between mitosis &amp; meiosis? A.mitosis is used to pr
    13·1 answer
  • Do both plz
    7·1 answer
  • How do geologist look at a mountain and determine its approximate age based on physical features?
    14·1 answer
  • Mr. Fuad and Mr. Razak live as neighbours in a village near the sea. Mr. Fuad is a fisherman while Mr. Razak teaches at a school
    6·1 answer
  • Five ways water is important to you in your daily life.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!