1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrej [43]
3 years ago
13

What is the major structural difference between starch and glycogen?

Biology
1 answer:
inessss [21]3 years ago
8 0

Answer:

Main Differences Between Glycogen and Starch Glycogen is made up of the single-molecule whereas starch is made up of two molecules namely amylose and amylopectin. Glycogen forms the branched-chain structure whereas Starch forms linear, coiled, and branch structure.

You might be interested in
Cuales son las ideas principales e ideas secundarias de la historia de la química?​
geniusboy [140]

Answer:

La historia de la química abarca un periodo de tiempo muy amplio, que va desde la prehistoria hasta el presente, y está ligada al desarrollo cultural de la humanidad y su conocimiento de la naturaleza. Las civilizaciones antiguas ya usaban tecnologías que demostraban su conocimiento de las transformaciones de la materia, y algunas servirían de base a los primeros estudios de la química. Entre ellas se cuentan la extracción de los metales de sus menas, la elaboración de aleaciones como el bronce, la fabricación de cerámica, esmaltes y vidrio, las fermentaciones de la cerveza y del vino, la extracción de sustancias de las plantas para usarlas como medicinas o perfumes y la transformación de las grasas en jabón.

4 0
3 years ago
How are prokaryotes useful to our world? Provide one example
Nataliya [291]
They train our immune system so it's ready when our bodies are attacked, and they aid in digestion and supply us with vitamins. ... Scientists and doctors can even utilize prokaryotes to help the human body.
7 0
3 years ago
Some bacteria have an impact on human nutrition. what vitamin does our intestinal bacteria synthesize that we absorb for our use
Gre4nikov [31]
The answer is vitamin k
8 0
4 years ago
Use the diagram to answer each question. How do volcanoes form at A?  
Andre45 [30]

Answer:

Volcanoes are formed at the divergent and convergent plate boundaries.  

<u>During a divergent plate motion, along the mid-oceanic ridge, seafloor spreading takes place. Here it is represented by location B. Due to this, the magma becomes extremely hot and exerts an upward pressure towards the seafloor</u><u>. </u><u>As a result of which the ocean floor slowly rises up forming sea volcanoes.</u> The eruption takes place and the lava forms and deposits on the seafloor, near and along the mid-oceanic ridge. As this region undergoes continuous spreading, so the crust comprised of these rocks slowly moves away from the ridge.

4 0
4 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Other questions:
  • "in the arctic, scientists are using a device called the "rosette." the rosette helps the scientists __________."
    10·1 answer
  • A lichen is composed of two distinct organisms living together that behave like a single organism. true false
    14·1 answer
  • In which part of a plant would you NOT expect to find cells with chloroplasts?
    12·1 answer
  • What are peptide bonds in protein how manny are there?<br> (includes diagram)
    11·1 answer
  • What role does dna replication play in the cell cycle
    13·1 answer
  • The arrow is pointing to the<br> in a plant cell.
    13·1 answer
  • Biotic factors are the _____things in an environment? Multicellular, Eukaryotic, living or used to be living, Non living
    6·1 answer
  • What are three kinds of volcanoes? What makes them different?
    6·1 answer
  • How does the shape of vomerine teeth help it preform its function?(holding prey) This question is about frogs in case there is a
    14·1 answer
  • Bio chem question<br><br>Explain why​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!