1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neko [114]
2 years ago
15

3. What two molecules are produced during Photosynthesis?

Biology
2 answers:
loris [4]2 years ago
5 0

Explanation:

photosynthesis requires sunlight, carbon dioxide and water as starting reactants (figure 5.5). After the process is complete, photosynthesis releases oxygen and produce carbohydrate molecule, most commonly glucose. These sugar molecules contain the energy that living things need to survive.

During the process of photosynthesis, cell use carbon dioxide and energy from the sun to make sugar molecules and oxygen.

Nina [5.8K]2 years ago
4 0

Answer:

outputs Glucose, oxygen

Explanation:

You might be interested in
What is the bond that connects monomers in lipids. Plz help asap
lord [1]

Answer:

They are called covalent bonds.

Explanation:

I just went through the lesson.

6 0
3 years ago
Read 2 more answers
Some phenotypes, such as eye color, are controlled by multiple genes. if eye color was controlled by 5 genes, how many possible
Harlamova29_29 [7]
5 because each gene could be expressed 
6 0
3 years ago
Meiosis produces four nuclei that have different chromosome numbers
pentagon [3]

Answer:

I would say true

Explanation:

they do produce 4 different chromosomes

8 0
2 years ago
Read 2 more answers
The nutritive value of sunflower seeds a brief note
Mice21 [21]
<h2>Nutritive Value if Sunflower Seeds are:--</h2>

100 grams of these seeds give around 585 calories of energy.

They have a good amount of fibre (8.5 g) and fats (51.5 g). Fats present are mostly polyunsaturated and monounsaturated; which are good fats

They are also rich in protein (20.77 g).

6 0
2 years ago
Suppose that a leaf disk that has had the air sucked out is placed in bicarbonate solution under a dim light that results in a l
saul85 [17]

The answer is; NO


This is because the leaf would not have tiny oxygen bubbles spread across its base (because the base is where most stomata are) that would help it float on the water. The reason is that the oxygen produced in the process of photosynthesis would be consumed in respiration because the rates of the two biochemical processes are the same.


8 0
3 years ago
Other questions:
  • Identify each adaptation as structural or behavioral adaptations.
    11·2 answers
  • Approximately how many chloroplasts were present in each elodea cell
    11·1 answer
  • A young man is injured in a car accident and requires a transfusion. upon testing we see his blood reacts with anti-a and anti-r
    12·1 answer
  • Which of the following was one of the purposes of the Gemini project?
    6·2 answers
  • Bones kept in hydrochloric acid becomes soft why?
    10·1 answer
  • An enzyme called glucocerebrosidase breaks down a glycolipid in the body known as glucocerebroside. However, in a genetic diseas
    7·1 answer
  • 3. Which of the following is a major functional characteristic of all organisms? (a) movement,
    7·1 answer
  • In the USA, many people want to cut their
    10·2 answers
  • 1
    13·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!