1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blsea [12.9K]
3 years ago
13

Using the science behind macro-nutrients, why marathon runners are so skinny?

Biology
2 answers:
olga55 [171]3 years ago
7 0
This is because they train extremely hard in order to sustain stamina and endurance so, their bodies don't get the chance to build muscle because they burn more than they consume.
VMariaS [17]3 years ago
6 0
Professional marathon runners are also skinny because they train so hard to sustain endurance. This prevents their bodies from bulking up because they burn almost all the calories that they consume. Unlike sprinters, who need muscles, marathon runners don't need muscles at all.
You might be interested in
What are organelles and what do they do?
FromTheMoon [43]
Organelles are different parts of a cell as like different organs in a human body. Each organelle carry out a specific function and work together with other organelles for the cell to function.

organelles- cells- tissues- organs- organism


4 0
4 years ago
Years ago, scientists determined that all mitochondrial DNA in humans came from a common African ancestor. Based on this informa
ryzh [129]
I'm 100% Confident it's (A) <span>All modern humans evolved from one group of African H. sapiens.
</span>
4 0
3 years ago
Read 2 more answers
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0
4 years ago
I'm so confused... please help
icang [17]

Answer:

Metaphase

Explanation:

Chromosomes align at the center of the cell

5 0
3 years ago
What is the relationship between the kinetic energy of molecules in an object and the object 's temperature
fenix001 [56]
Temperature is a measurement of the average kinetic energy of the molecules 
in an object or system.

5 0
4 years ago
Other questions:
  • What is population density?
    9·1 answer
  • I am having a cumulative exam today on edgnuity, got any tips for me to do well on it?
    5·2 answers
  • In c4 and cam plants carbon dioxide is fixed in the _____ of mesophyll cells.
    5·1 answer
  • Why do sex-linked traits follow different patterns of inheritance than other traits? A. Males have two X chromosomes, and female
    14·2 answers
  • The nematode Ascaris lumbricoides infects humans, spending most of its adult life inside the intestines of its host. To be infec
    8·1 answer
  • The Calvin cycle:
    6·2 answers
  • what process do the arrows for oxogen going in and the water coming out represents in the figure 9-2 diagram of the mitochondria
    15·1 answer
  • What does it mean to say that two chromosomes are homologous?
    6·1 answer
  • 12. Which is NOT a natural cause of extinction?
    14·1 answer
  • What are 3 biotic factors that affect an organism after death.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!