1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksju [112]
2 years ago
8

#4 The right side of the heart pumps blood only to the ____________ .

Biology
2 answers:
Ierofanga [76]2 years ago
7 0

Answer:

"lungs" is the answer you were looking for!

Explanation:

Please give me brainliest :)

krok68 [10]2 years ago
6 0

Answer:

the lungs only

Explanation:

You might be interested in
What would be the complimentary strand for the DNA sequence <br> ATAACGA
vladimir1956 [14]
I believe it is TATTGCT
6 0
3 years ago
Read 2 more answers
The image on the left shows a normal red blood cell, and the image on the right shows a cell that has been put into a new soluti
horrorfan [7]

Answer:

The water molecules move by active transport into the cell from low water concentration to high water concentration

5 0
3 years ago
Read 2 more answers
A patient wearing a ________ monitor wears a small portable ecg monitoring device for a period of 24 hours
goldfiish [28.3K]

Wearing a heart monitor

7 0
3 years ago
Organisms that cannot make their own food are called:
Licemer1 [7]

Explanation:

Heterotroph. 100% correct. Goodluck. glad to help.

3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • A dog, Skipper, is roaming around in his neighborhood. Skipper passes one of his favorite spots and he lifts his leg to urinate
    14·1 answer
  • The benefit of social behavior that refers to searching for and collecting food is referred to as
    14·2 answers
  • If you have 100 grams of different substances, the least dense substance would have which volume? 10 l 100 l 1 l 0.10 l
    11·1 answer
  • How does the atmosphere make conditions on Earth suitable for living things?
    9·1 answer
  • A warm-up routine should ________ your body temperature.
    12·2 answers
  • The crust and the upper layer of the mantle together make up a zone of rigid, brittle rock called _____.
    7·1 answer
  • • What happens to the pH of the battery acid?
    10·1 answer
  • How many parent isotopes based on half lives
    14·1 answer
  • Please help! Just one question! :)
    10·1 answer
  • Alicia contracted chicken pox when she was a child and her son John recently contracted the disease. Explain fully how Alicia re
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!