Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
For one to form, there needs to be warm ocean water and moist, humid air in the region. When humid air is flowing upward at a zone of low pressure over warm ocean water, the water is released from the air as creating the clouds of the storm. As it rises, the air in a hurricane rotates.
Explanation:
In short pressure zones over warm ocean
Answer:
The average energy of motion of particles in a substance is its kinetic energy. Therefore, temperature is the measure of the average kinetic energy of the particles of a substance. The thermal energy of the substance is the total energy of the substance.
Explanation:
Answer:
Explanation:
Studying history enables us to develop better understanding of the world in which we live. Building knowledge and understanding of historical events and trends, especially over the past century, enables us to develop a much greater appreciation for current events today.
hope thats what your looking for
Quite possibly. It would be easier to take control over a brain that is at its most non active state which happens when it is dark, or very bright