1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
3 years ago
11

According to the Cell Theory, what is the unit of structure for living things?

Biology
2 answers:
Sveta_85 [38]3 years ago
6 0
Cells are the basic units of structure and function in living things, all cells are produced from other cells, all living things are composed of cells.
Stolb23 [73]3 years ago
3 0
<span>All living things are composed of one or more cells.The cell is the basic unit of life and new cells arise from existing cells. The cell is the fundamental unit of structure and function in living things. All organisms are made up of one or more cells.

Hope this helped.
</span>
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
. What causes a hurricane to form <br><br><br> will give brainliest to smartest answer
Archy [21]

Answer:

For one to form, there needs to be warm ocean water and moist, humid air in the region. When humid air is flowing upward at a zone of low pressure over warm ocean water, the water is released from the air as creating the clouds of the storm. As it rises, the air in a hurricane rotates.

Explanation:

In short pressure zones over warm ocean

8 0
2 years ago
Read 2 more answers
Describe the relationship between particle motion, temperature, and thermal energy.
Andreas93 [3]

Answer:

The average energy of motion of particles in a substance is its kinetic energy. Therefore, temperature is the measure of the average kinetic energy of the particles of a substance. The thermal energy of the substance is the total energy of the substance.

Explanation:

7 0
3 years ago
HELPP PLEASE!!! I’ll MARK YOU IF YOU ANSWER PLEASE
Scorpion4ik [409]

Answer:

Explanation:

Studying history enables us to develop better understanding of the world in which we live. Building knowledge and understanding of historical events and trends, especially over the past century, enables us to develop a much greater appreciation for current events today.

hope thats what your looking for

6 0
3 years ago
Is hipnotism related with darkness?
katrin [286]
Quite possibly. It would be easier to take control over a brain that is at its most non active state which happens when it is dark, or very bright
3 0
3 years ago
Other questions:
  • Is this a testable question ?
    10·2 answers
  • The surgical repair of a vessel is _____.
    7·1 answer
  • 1,why Dna coiled to histone protien 2,what is difference bewteen co-factor and prosthetic group 3,why child get mitrochondrion f
    13·1 answer
  • The registered nurse is teaching the nursing process in psychiatric mental health nursing to a group of student nurses. Which st
    5·1 answer
  • If all the leaves are removed from a lycophyte, which process would affected?
    5·2 answers
  • Which is the basic functional unit of life?
    12·2 answers
  • Why do you think the distribution of fur traits changed over time?​
    12·1 answer
  • What organelle is huge in plant cell but small in Animal cell
    13·1 answer
  • On topographic maps, contour lines that are close together indicate?
    11·1 answer
  • Helpppppppppdhhdudhdjdjdnndj
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!