The abdominal cavity is lined by peritoneum. It is a membrane that covers the inner layer of the cavity and also the organs inside. The membrane on the inner wall is parietal Thperitonium and the membrane that lines the organ is called visceral peritoneum. This helps in fixation and support of abdominal organs.
Pretty sure its false, will get back to you c:
The biggest difference is the cause. The solar wind is a constant flow of particles from the sun's corona due to their high energy gained from the sun's interior, it's like being boiled off. CME's and flares are the result of “explosive” releases of energy from the sun's magnetic field. Solar flares and solar winds originate within the sun's atmosphere, but differ greatly from one another. Satellites on Earth and in outer space allow a look at solar flares, but you cannot see solar winds directly. However, the effects of solar winds reaching Earth appear to the naked eye when the aurora borealis and aurora australis electrify the night sky.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The answer to the question that is being presented above would be the phrase 'Mendel's law of inheritance'. <span>Family pedigrees are based on scientific evidence that is described by Mendel's law of inheritance. The other choices do not describe the statement better.</span>
