1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dangina [55]
2 years ago
12

13. Which muscle allows you to flex your big toe?

Biology
1 answer:
enot [183]2 years ago
8 0

Answer:

Flexor hallucis longus

Explanation:

This muscle lies deep inside your leg. It runs down the lower leg all the way to the big toe. It helps you flex your big toe so that you can walk and hold yourself upright while on your tiptoes.

You might be interested in
What does the "oxidative" in oxidative phosphorylation mean?
ololo11 [35]

Answer:

B

Explanation:

Oxygen is the final acceptor of electrons in the process of oxidative phosphorylation. Without oxygen, the process becomes jammed with electrons.

3 0
2 years ago
A very active person uses a large amount of energy and therefore has a high
mamaluj [8]
A) a temperature is regulated by the body: so, not.

b) - rather not, most likely cholesterol level would be low

c) this is rather intedependent - a person can be active even without a fat diet.

d) I think this is the best answer. Metabolism is the exchange of energy in food into the energy that people use.
7 0
3 years ago
Read 2 more answers
The ________ is a substage lens that concentrates light on the specimen.
stiks02 [169]

Answer:

microscope's condenser

Explanation:

The microscope's condenser is a substage lens that concentrates light on the specimen.

<em>The condenser of a microscope is a structure that helps concentrate light rays from the light source to illuminate the specimen on the stage of the microscope. It is made up of a system of lens that converges the ray of light and an aperture diaphragm that can be used to control the amount of light that gets to the specimen on the stage of the microscope.</em>

6 0
2 years ago
Humans have greatly increased the level of in the atmosphere. O A. argon B. oxygen O . C. carbon dioxide O D. nitrogen
hammer [34]

Answer:

Humans have greatly increased the level of in the atmosphere. O A. argon B. oxygen O . C. carbon dioxide O D. nitrogen

=carbon dioxides

6 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • The virulence factor associated with the events of gram negative sepsis and septic shock is _____
    11·1 answer
  • Study the diagram below. In which order does oxygen flow through the human circulatory system?
    14·1 answer
  • The study of health and disease within a geographic context and from a spatial perspective is
    13·1 answer
  • Where in the cell is the tag incorporated into the protein?
    15·1 answer
  • Which answer is it need it quick please‼️
    11·2 answers
  • Which is the only reason to take an anabolic steroid?
    6·2 answers
  • How many organelles are in both plant and animal cells?
    14·1 answer
  • Use of fossil fuels has increased the total amount of carbon in the carbon cycle.
    6·2 answers
  • What is biology and its branches?
    7·1 answer
  • This is worth 100 points. Please answer and do not skip over this question.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!