Answer:
could be either or, but the name of the shape is a double helix.
Explanation:
Water-borne diseases, including cholera, typhoid, and dysentery, are caused by drinking water containing infectious viruses or bacteria, which often come from human or animal waste. Water-washed diseases, such as skin and eye infections, are caused by lack of clean water for washing.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Different I think is your answer
Answer:
Thalidomide may be defined as a type of the sedative drug that in the earlier time referred for the pregnant ladies. This drug causes the world wide tragedy and acts as a teratogen.
This drug causes mutation in the fetus. The Ames test is effective to understand the mutagenicity of the drug. In this test, if the auxotrophic strain of the bacteria is grown on the the deficient media containing thalidomide drug. The bacteria growth indicates the positive Ames test and the substance is considered as mutagen.
