1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alisiya [41]
3 years ago
12

After vigorous exercise, the muscles involved show a marked the increase in the concentration of

Biology
1 answer:
Eduardwww [97]3 years ago
5 0
The answer is C lactic acid
You might be interested in
I will mark brilliant.<br><br> Do 13 through 15
SIZIF [17.4K]
13) Electrical Energy is turned into Light and Sound, and as always Heat

14)Potential and Kinetic

15)Insulators who do not freely allow electricity to flow freely
5 0
4 years ago
True or false our atmosphere is very thin compared to the size of the Earth?​
irakobra [83]

Answer:

true

Explanation:

hope this is helpful.

4 0
3 years ago
Read 2 more answers
(50 Points)
kicyunya [14]

Answer:

gg

Explanation:

Not 50 pts but... recessive usually means it's the tiny letters.

Dominant traits have capital letter GG or Gg, so the dominant trait is going to show as the phenotype.

4 0
3 years ago
PLEASE HELP!! WILL GIVE BRAINLIEST!!! DUE NOW!
Travka [436]

The answer is B: Water breaks down into oxygen molecules for respiration.

7 0
3 years ago
Read 2 more answers
What is the fleshy tab of tissue that hangs down the back of the throat called?
kondaur [170]
........................
The Uvula
........................
5 0
4 years ago
Other questions:
  • Name three resources for which organisms might compete. (0.6 pts)
    5·1 answer
  • It is hard to believe, but the desert and the tundra have a lot in common! The most obvious is that both biomes have little avai
    13·2 answers
  • An organism's genomic dna is analyzed and found to contain 22% thymine. what percentage of that organism's dna is guanine?
    5·1 answer
  • A nurse is caring for a child with tinea pedis. which assessment finding should the nurse expect
    14·1 answer
  • Why do some life activities strengthen the substrate while others weaken it?
    10·1 answer
  • According to cell theory, select one:
    5·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Describes natural selection?
    6·1 answer
  • Match the activities to their respective categories.
    11·1 answer
  • Explain how the farms upriver were adding to the high nitrate levels. (Gizmo)
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!