<span>d. Not all rainforests are tropical rainforests.</span>
Not all rainforests are tropical rainforests because some are distinguishable from the others and these rainforests has its own designated climate that allows the specific species of plants to grow and thrive in that environment.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Coral reefs are found in the photic zone of aquatic biome.
Explanation:
The ridges of ocean that are formed by invertebrates of marine system which lives in the superficial warm water are the Coral reefs. These are found in the ocean zone- photic. This is the uppermost surface area of ocean where abundance of sunlight is found and photosynthesis takes place.
The reefs of shallow water have an association with algae, which is photosynthetic. One of such reefs is the Reef of Great Barrier in the Australian northeast coast.
Antagonist, which is a drug that inhibits the production of a chemical in the body. This is the opposite of an agonist drug.