its bumped because it stores water for the camel
All are except the first one. Microfilaments are designed for support of cell structure.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
Innate or natural immunity
Explanation:
Innate immunity is a defense system that we are born with and that protects us against antigens. It is the sum of all defense mechanisms that occur naturally to protect an individual from infectious diseases. They are physiological mechanisms that are present throughout the entire animal kingdom and it is an inherent quality of each species.
They are not specific to a given pathogen, nor do they generate memory
Answer:
DNA
Explanation:
Because DNA information has already been copied in the mRNA and travels from the nucleus to ribosomes, where it works with tRNA to produce proteins. GTP is a molecule used as an energy source in the translation process.
