1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mote1985 [20]
3 years ago
7

Do animals have cell wall​

Biology
2 answers:
kakasveta [241]3 years ago
5 0

hi miss how are you kya kar Raha hoo

Semenov [28]3 years ago
4 0

Explanation:

Nope ..................

You might be interested in
When instructing the parents of a child who has received immunization in the vastus lateralis, which reaction is most common in
pishuonlain [190]

Answer:

The correct answer will be option-D

Explanation:

Vastus lateralis or anterolateral thigh is the muscle of the thigh which is the largest and the most powerful muscle in the thigh. The vastus lateralis is recommended as a site for intramuscular injection in infants.

A vaccine or immunoglobulin in infants must be given either in deltoid or the vastus lateralis muscle. When the injection is given in the vastus laterlis, after post-vaccination a temporary pain with tenderness and redness is observed at the site.

Thus, Option-D is the correct answer.

3 0
3 years ago
Read 2 more answers
Which of these sentences describe sources and preservation of genetic variation? Select all that apply.
saul85 [17]

Genetic variation can be defined as the difference in the DNA sequences between the individuals in the population

<u>Explanation:</u>

  • Antibiotic resistance in bacterial populations is caused by natural selection of bacteria that inherit mutations that make them resistant to the antibiotics,this sentence describes the source and preservation of genetic variation.
  • The Mutation is one of the genetic variation or disorder, and probably bacteria choose mutation to become repellent to antibiotics
  • In some of the cases of spontaneous bacteria have been  obtained from other sets of bacteria through the process  and make the bacteria repellent to an antibiotic.
  • They survive antibiotic treatment and increase in numbers by natural selection.
  • Natural selection can be stated as the process in which organism survive and reproduce adapting to the environment
6 0
3 years ago
What tissue creates movement of the animal
Juliette [100K]
The skeletal tissue is responsible for the movement in our body :)
6 0
3 years ago
You are testing a chemical that you suspect is a mutagen. You set up an AMES test, and for your control (without the mutagen add
Reptile [31]
<h2>Mutagenic characteristic of chemical</h2>

Explanation:

  • The earth we live in really affects whether we experience hereditary transformations. The nature of water we drink and the air we inhale can really influence the uprightness of our DNA. Our bodies are intended to address any slip-ups, however, risks from the earth can expand our odds of winding up with a change. A natural operator that causes a transformation is known as a mutagen
  • chemical mutagens are standard instruments for mutagenesis in a variety of living things, and they are a fundamental strategy for making changes in phenotype-based screens in most genetic structures. Although in the exploratory arrangement, all whole animal screens incorporate the time of lines harboring transformed chromosomes followed by the examination of the consequent phenotypes in the heterozygous or homozygous state
  • Hence, the right answer is "chemical is not mutagenic in nature"

3 0
4 years ago
How are biotic factors in the marine ecosystem responsible for bringing carbon-dioxide into the ocean?
Wewaii [24]

Answer:

Marine ecosystem have biotic organisms like phytoplankton and photosynthetic algae that do photosynthesis and converts the atmospheric carbon dioxide into organic matter most of the carbon dioxide is released when other organisms eat phytoplankton and release the carbon dioxide through respiration.

But some of the algae and phytoplanktons die naturally get down to the bottom of the ocean where they make carbon sink. Some organisms accumulate CO₂ in their exoskeleton that is made up of calcium carbonate.  

Therefore this use of carbon by living organisms in oceans brings carbon dioxide from the atmosphere to oceans. This is why the ocean plays a critical role in the carbon cycle and called carbon sink.

7 0
3 years ago
Other questions:
  • What happened to the guy who ate ten pounds of powdered food for dinner math answers?
    7·2 answers
  • Terry is a 22-year-old woman who weighs 132 pounds. using the simple "rule of thumb" method, what is her estimated 24-hour basal
    9·1 answer
  • Which of these is a significant effect of vascular plants?
    5·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Life as we know it depends on the genetic code: a set of codons, each made up of three bases in a DNA sequence and corresponding
    13·1 answer
  • Why is most of the mass of the atom in the nucleus?
    7·1 answer
  • Define cell and atom​
    7·1 answer
  • How many cells do you start with for mitosis?
    5·1 answer
  • What is the importance of ATP and NADPH?​
    13·1 answer
  • A product of the anterior pituitary gland that causes color changes in its target cells is ________. A. follicle-stimulating hor
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!