1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
romanna [79]
3 years ago
5

What's metamorphism?

Biology
1 answer:
DanielleElmas [232]3 years ago
7 0

Answer:

D) The process by which new minerals form as a result of precipitation from an aqueous solution

You might be interested in
When a newly formed cell enters into interphase and begins conducting metabolic functions, it is in _____.
ANEK [815]
When a newly formed cell enters into interphase and begins conducting metabolic functions it is in G1. The G1 phase is the first of four phases that take place during cell division of eukaryotic cells. 
8 0
3 years ago
What is a hypotheses
Luden [163]

Answer:

An educated guess before doing an experiment

3 0
3 years ago
Read 2 more answers
Which organelles are involved in energy conversion? (1 point)
12345 [234]
What? Ermmn... Answer to that top question is A.
7 0
4 years ago
Which process makes it possible for all the major organs of the body to be formed by week 10 of human
yKpoI14uk [10]

Answer:

Differentiation

Explanation:

The process that makes it possible for all of the body's major organs to be formed by the tenth week of gestation is known as differentiation.

3 0
4 years ago
Read 2 more answers
Skin color is determined by three to five gene pairs. this makes skin color
kolezko [41]
Pigment photosynthesis and the comeellianGene
7 0
4 years ago
Other questions:
  • What are flagella? a. hairlike fibers for mobility b. bacteria found on plants c. fruit that grows in rain forests d. leaves fou
    13·2 answers
  • The force of gravity between two objects depends on _ and _
    8·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • When a behavior is followed by negative reinforcement, the behavior is likely to
    5·1 answer
  • 1. What is proper "posture" (way of standing) to ensure good singing technique?
    6·2 answers
  • Which is most likely an example of pseudoscience?
    5·1 answer
  • List developmental changes in animals
    13·2 answers
  • Match the population ecology term to its definition.
    13·1 answer
  • Which function is mostly performed in the fleshy tissue parts of a plant, rather than in the tissues that make up the upper laye
    6·1 answer
  • Mutations in the nucleic acid sequence of a gene can sometimes direct the substitution of one amino acid for another in the enco
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!