1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
15

Someone plz help me :(

Biology
2 answers:
taurus [48]3 years ago
8 0
I believe it’s A! Eukarya do have a nucleus.
Eukaryotic cells are not ALL multicellular, because they can be unicellular too. They are definitely not made up of prokaryotic cells.
As I said before, they have a nucleus so it’s not D. It’s A! Hope this helped, Good luck!!
Shalnov [3]3 years ago
6 0

Answer:

its a

Explanation:

eukarya and eukaryotic see the similarities?

You might be interested in
What is the source of energy in the water cycle
tino4ka555 [31]
The sun is a source of energy
6 0
3 years ago
Which of the following statements about ATP-powered pumps is NOT true? All ATP-powered pumps contain at least one transmembrane
MAVERICK [17]

Answer:

Only P-, F-, and V-class pumps transport ions.

Explanation:

The distinct classes of ATPases include:

1) Only the P-type ATPase actively transports ions across biological membranes. P-ATPases (also named E1-E2 ATPases) are found both in plasma and organelle membranes. These ATPases serve to transport ions and phospholipids by hydrolyzing ATP to ADP and phosphate.

2) A- and F-ATPases synthesize ATP by transforming the energy from a gradient of ions across the cell membrane.

3) V-ATPase (also known as Vacuolar-H+ ATPases) acidifies vacuole, lysosome, endosome and Golgi membranes. This type of ATPase couples the hydrolysis of ATP to the active transport of protons across biological membranes.

4) E-ATPases hydrolyze extracellular ATP.

5 0
3 years ago
Drag the tiles to the correct boxes to complete the pairs.
Ulleksa [173]

bottleneck effect --- > A disease wipes out almost 90% of a population of birds, but the species adapts, and after 5 years its numbers increase dramatically.


gene flow --->  A population of rats travels on a cargo ship and mate with rats in a new region.


founder effect ---> Biologists introduce a small population of lizards on an island as part of a conservation effort.



mutation ---> A change in a DNA sequence causes a lizard to develop a darker skin color, which helps it hide from predators.


7 0
3 years ago
Read 2 more answers
In terms of gravitational political energy,what happens to a ball as it rolls down a hill?
Andrew [12]

The gravitational potential energy of the ball decreases as it rolls down the hill while the gravitational kinetic energy of the ball increases due to its acceleration in velocity.

4 0
3 years ago
What do electrons in the same shell have in common​
alina1380 [7]

Answer:It predicts and lists all chemical elements in the universe. What do electrons in the same shell have in common? They all have the same amount of energy. ... They cannot be broken apart without losing their chemical properties.

Explanation:I took a quiz on it

8 0
3 years ago
Read 2 more answers
Other questions:
  • In oxidation, is needed to create a chemical reaction.
    6·2 answers
  • Why can't you put your hand through a solid table?
    8·1 answer
  • How does being a self directed learner affect a person's health literacy?
    9·2 answers
  • Which blood test is performed to measure the level of glucose after the patient has not eaten for at least 12 hours?
    10·1 answer
  • It has been observed that some moth species emit
    9·1 answer
  • What does the cardiovascular system do?
    11·2 answers
  • Human somatic cells have 46 chromosomes. How many chromosomes are present in each gamete before fertilization?
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How do you think that wearing personal protective equipment helps to protect us from contracting airborne diseases?
    9·1 answer
  • How do plants use nitrogen?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!