1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexira [117]
3 years ago
15

does anyone have the answers to the unit 5 lesson 10 history unit test on migration and cultural exchange????????

Geography
1 answer:
snow_tiger [21]3 years ago
7 0

Answer:

If you search "unit 5 lesson 10 history unit test quizlet" you might get it. Make sure you include the word "Quizlet" at the end.

Explanation:

You might be interested in
Select all that apply.
Zepler [3.9K]
Deforestation and mining
6 0
3 years ago
Read 2 more answers
Which ones right I’ll give brainliest
Dmitrij [34]

Answer:

Well most transform boundaries are found on the sea floor, so I will have to say the second one.

Explanation:

5 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Suggest two reasons why estimates of future urban population may not be<br> accurate.
Temka [501]

Answer:

because there might be changes in the future which could make the estimates unreliable for example war or decline in economy

Explanation:

6 0
2 years ago
Read 2 more answers
Did oligarchs earn their money in a honest way?
wel
Hey there!
Oligarchy is rule by the rich, usually aristocrats. They indeed did not get their money in an honest way. In most oligarchies, they made laws that benefitted themselves, like unfair tax and odd charges. A common outcome of this type of government is making the rich richer and the poor poorer.
Hope this helps!
6 0
3 years ago
Other questions:
  • What was one of the difference between the roles of nobles and commoners in Aztec society?
    5·2 answers
  • You pass an officer making an arrest on the street. You hear her say to the suspect, "You have the right to remain silent. If yo
    13·1 answer
  • Jupiter has a mass of about 318 times the mass of Earth and a diameter of about 11.2 times the diameter of Earth. The accelerati
    11·1 answer
  • Which factor helps determine weather patterns across South America?
    14·1 answer
  • How has technology change agriculture?
    7·1 answer
  • Explain how the supply of fuelwood is affected by human population growth
    7·1 answer
  • Review the map.
    8·2 answers
  • In circle B with \text{m} \angle ADC= 53^{\circ}m∠ADC=53 ∘ , find the angle measure of minor arc \stackrel{\Large \frown}{AC}. A
    9·1 answer
  • What is a democratic republic? The president appoints the representatives. The people vote for the representatives. The congress
    8·2 answers
  • What is groundwater, and how does it relate to the water table?.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!