1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elden [556K]
2 years ago
9

How would this impact the organism?

Biology
1 answer:
Firdavs [7]2 years ago
4 0

Answer:

how would what impact the organism?

You might be interested in
Which cells are most likely to react in the event that there is a reduction in the supply of oxygen to a person s foot?
SOVA2 [1]
A principle that is not associated with the cell theory is that very few cells reproduce. In fact all cells reproduce because they are the basic units of life.<span>2 people </span><span>found this useful</span>
5 0
4 years ago
Compare an animal with a gastrovascular cavity to an animal with a tube-type digestive system. What is(are) the major advantage(
bonufazy [111]

Answer:

hello your question lacks the required options

Group of answer choices

It allows the animal to consume a second meal while the first is being digested.

It permits development of specialized enzymes and concentration of digestive juices in different regions.

It permits more time for enzymatic action.

Additional physical cutting and grinding of the food bolus is made possible.

All of the above are advantages

answer : All of the above are advantages

Explanation:

An animal with a gastrovascular cavity has some advantages over the animal with a tube-type digestive system . a gastrovascular cavity allows for the digestion and transport of nutrients across the body and is found in phyla and Platyhelminthes

The major advantages the gastrovascular cavity has includes :

It allows the animal to consume a second meal while the first is being digested.

It permits development of specialized enzymes and concentration of digestive juices in different regions.

It permits more time for enzymatic action.

Additional physical cutting and grinding of the food bolus is made possible.

4 0
3 years ago
Select the four natural events that could cause local competition for natural resources.
Ket [755]

Answer:

hurricane, tornado, drought, flood

Explanation:

7 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
What are the economic activities in the Amazon forest
Musya8 [376]

Answer:

A substantial part of the Amazon rainforest economy comes from illegal activities, like drug dealing, biological trade and wood cutting. Most drugs that reach Europe and United States are not farmed in the region, but Amazon rainforest serves as a path to drug dealers to deliver their production

Explanation:

4 0
3 years ago
Other questions:
  • PLEASE HELP ME I'LL MAKE YOU BRAINLIEST!!!!!!!!!! Lichens can best be described by which of the following? a) autotrophic organi
    10·2 answers
  • Is the dna soluble in the aqueous solution or alcohol?
    9·1 answer
  • Scan my book to see the answer
    9·1 answer
  • The cessation of menstruation after no more developing follicles remain is called
    10·1 answer
  • Water flows over gills in the opposite direction of blood flow in a process known as:
    8·1 answer
  • What are structures that absorb wavelengths of color.
    8·1 answer
  • /the leading cause of death globally, resulting in 7.3 million deaths each year, is:
    15·1 answer
  • The sugar in RNA is, the sugar in DNA is
    8·1 answer
  • Pl help it’s for a grade
    14·1 answer
  • The transport of water through a plant depends on roots absorbing water. Roots depend on osmosis to obtain water. In osmosis, wa
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!