Answer:
False
Explanation:
Scientist believe that the primitive atmosphere lacked free oxygen. Oxygen is a highly reactive molecule that would have made difficult for complex macromolecules to appear and then create life. Rocks from the precambrian period support this theory.
Anaerobic cells appeared first, then photosynthesis appeared filling the atmosphere with oxygen and the aerobic organism develop cellular respiration to obtain energy, a process more efficient than anaerobic respiration.
Answer:
The correct option is C. The cell followed Kreb's pathway.
Explanation:
Krebs cycle can be described as a metabolic pathway for the release of energy during the process of aerobic respiration. The Kreb's cycle constitutes a series of oxidation reactions through which pyruvate is converted into carbon dioxide. About 15 moles of ATP is released as a result of Kreb's cycle. The reactions of the Kreb's cycle take place mostly in the mitochondria. The Kreb's cycle is commonly named as the Citric Acid Cycle.
<span>The waste leaves through the cell membrane</span>
In a centrifuged sample of blood the PLATELETS should not be in the plasma portion of the sample. Centrifugation of blood samples separates the blood to its constituents on the basis of their densities. Platelets will be found on the middle region of the separation and not in the upper region where plasma is .
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
