1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shalnov [3]
2 years ago
11

When we say a trait has been selected for this means that quizlet

Biology
1 answer:
Nikitich [7]2 years ago
6 0

Answer:

When we say that a trait has been "selected for", this means that. individuals with that trait reproduce more than individuals without that trait.Explanation:

You might be interested in
HELP QUICK!!
drek231 [11]

Answer:

B.) Carbon and Hydrogen

Explanation:

Lactose is a carbohydrate, and carbohydrates are primarily made of carbon and hydrogen chains.

4 0
2 years ago
What is the part of the cell cycle process by which chromosomes in a cell nucleus are separated into two identical sets of chrom
Damm [24]

Answer:

Mitotic phase

Explanation:

Cell cycle is composed of interphase and mitotic phase. Interphase is aphase of cell preparation. It is subdivided into:

  • G1 (gap 1 phase)-the cell grows and becomes larger
  • S phase- replication of DNA, duplication of centrosomes
  • G2 (gap 2 phase)-proteins and oranelles are made

Mitotic phase is phase of cell division, chromosomes are separated, daughter cell get identical sets of chromosomes. It is followed by cytokinesis-separation of cytoplasm. Stages of mitosis are:

  • prophase-condensation of chromatin into chromosomes,  the nuclear envelope breaks down, mitotic spindle formation
  • metaphase-the chromosmes line up (metaphase plate)
  • anaphase-the siste chromatides move toward opposite cell poles
  • telophase-the nuclear envelope forms again, cell division is almost complete
3 0
3 years ago
Name the three structures of seed plants, and explain their functions.
Alchen [17]
The three principal organs of seed plants are roots, stems, and leaves. Roots: absorb water and dissolved nutrients. anchor plants in the ground.
4 0
2 years ago
Read 2 more answers
Dated to approximately 500,000-400,000 years ago, the site of _______ has yielded a sample of 4,000 fossil fragments representin
Luden [163]

Answer:

c. ​Sima de los Huesos

Explanation:

7 0
3 years ago
Which skin function is not correctly matched with the structure that accounts for that function?which skin function is not corre
Mumz [18]
Answer; (not correctly matched)
Apocrine gland; Thermoregulation;

Explanation;
Apocrine glands are found in the skin and the eyelids.
Most apocrine glands in the skin are in the armpits, the groin, and the area around the nipples of the breast.
They are scent glands, and their secretions usually have a odor. They empty into the hair follicle just before they open onto the skin surface. 
4 0
3 years ago
Read 2 more answers
Other questions:
  • At Point A of a stream the temperature reading is 11.8 degrees Celsius (°C). At Point B, father down the stream, the temperature
    13·1 answer
  • Explain why the formation of abscission layer causes sugar to accumulate in leaves.
    11·1 answer
  • Is the dermis of the skin composed of dense regular or dense irregular connective tissue?
    11·1 answer
  • Predict what would happen if a plant from a deciduous forest were transplanted to the tundra. Explain
    6·1 answer
  • Why are archaea in a different domain from bacteria?
    12·2 answers
  • 1. Can bacteria or viruses be seen with the naked eye?
    7·1 answer
  • Plz help thank you!!!
    10·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • What is an endangered species?<br> Your own words
    11·2 answers
  • What do stomata Get from the environment?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!