<u>While our globe may never run out of water as a whole</u>, it's crucial to realize that pure freshwater isn't always available where and when humans require it. In fact, only six countries contain half of the world's freshwater. Over a billion people do not have access to adequate safe, clean water. Water scarcity will afflict the entire planet by 2040 unless water use is significantly decreased. "If we keep doing what we're doing now, there will be no water by 2040."
Answer:
Arteries
Explanation:
There are three main types of blood vessels: veins, arteries, and capillaries. Arteries are the blood vessels that carry the oxygenated blood from the heart to various body parts. Veins pick the deoxygenated blood and deliver it to the heart to be oxygenated.
Arteries are the blood vessels with thick walls and no valves. Blood is pumped with higher pressure from the heart into arteries. The pulmonary artery is the only exception that carries deoxygenated blood from the right ventricle to the lungs for oxygenation.
When we perform a study, we test a specific hypothesis to see whether our hypothesis is supported by the data or not. If our hypothesis is not supported by the data, then we can argue that a specific argument (that would be important for this hypothesis) does not have a claim in scientific research.
This is more broadly meant though. Usually you need to perform multiple studies and test multiple hypothesis to be able to critique a scientific argument and see whether the claims it makes and the predictions it makes hold up in scientific research.
The reason why we were unable to read the lab manual through the tubes containing isotonic and hypertonic solution is because the cells in those solutions remained intact, causing the solutions to be opaque, in the tonicity of red blood cells activity. The reason why we can't read the lab manual is because the cells in the solutions remained intact.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
