1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irinina [24]
2 years ago
6

NO FAKE ANSWERS AND NO LINKS. How much oxygen does the atmosphere contain?

Biology
2 answers:
Andrew [12]2 years ago
8 0

Answer:

21%

Explanation:

To remember this percentage, use the amount of land and water on earth, like this: 3 (land) x 7 (water) = 21

(note: oxygen does not change depending on land or water amount)

kari74 [83]2 years ago
3 0

Answer:

The air in Earth's atmosphere is made up of approximately 78 percent nitrogen and 21 percent oxygen.

Explanation:

hope this helps

plz mark brainliest

You might be interested in
Which statement is true?
Ludmilka [50]

I think b. Proteins are polymers of amino acids is the correct answer

3 0
3 years ago
What are the inputs in cellular respiration?
tankabanditka [31]
The inputs are glucose and oxygen and the outputs are water and carbon dioxide.
5 0
3 years ago
Read 2 more answers
A person with type A blood (AO) is crossed with
riadik2000 [5.3K]

Answer:

25% type A, 25% type B, 25% type AB, 25% type O

If you put it into a punnett square:

          B                  O

A        AB                 AO

O       BO                 OO

you get 25% for each phenotype

7 0
3 years ago
Briefly describe the process you can use if you cannot find an ebp that matches your students and your resources.
luda_lava [24]
;ld;ldf d;lj lkdsjf lkds fj a;lkdjf lkdj fklsd jldsf jlkd fa;ls d fjkl;d f;aslf jlkds  f;lkf jewiory kjdfj kldfj dkfldk f;lkdafj;ldkf hahahahahahaha get trolled

8 0
4 years ago
Wetlands provide all of the following benefits EXCEPT
Nonamiya [84]

Answer:

I am not sure but I think it is 2

3 0
3 years ago
Other questions:
  • Whats the difference between solute and a solvent
    10·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What are the terms used to describe the movement of air into and out of the lungs?
    13·1 answer
  • A perceived increase in the volume of sound is best explained by ________.
    8·2 answers
  • During which step of mitosis do the chromatids line up in the middle of the cell? A. prophase B. telophase C. anaphase D. metaph
    6·1 answer
  • Which one of these is not an example of intracellular communication?
    14·2 answers
  • HELP PLEASE ASAP.<br> Why do stems have bark? What does the phloem do?
    7·1 answer
  • Líquido circulante de los vertebrados
    15·2 answers
  • PLEASE HELP⚠️⚠️⚠️⚠️
    5·2 answers
  • Write two or three sentences describing how the process in part a support all the tropic levels in the ecosystem ecosystem
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!