Explanation:
Answer is 2
It is a nonselective process, so it might cause an allele to disappear from the gene pool by chance.
I hope it's helpful!!
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Your answer would be <em><u>D. refrigerator coils keeping the refrigerator cold</u></em>
The cerebrum is the largest brain<span> structure in humans and </span>accounts<span> for about two-thirds of the </span><span>brain’s mass</span>
Answer:
Explanation:Complementary base pairing is important in DNA as it allows the base pairs to be arranged in the most energetically favourable way; it is essential in forming the helical structure of DNA. It is also important in replication as it allows semiconservative replication.
