1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aalyn [17]
2 years ago
7

In pea plants, round seeds are dominant to wrinkled seeds. If you cross two heterozygous plants, what would your ratios be for g

enotype and phenotype of the offspring?
Biology
1 answer:
Mila [183]2 years ago
5 0

Answer:

Genotype - RR - 25%, Rr - 50%, rr - 25% (1:2:1)

Phenotype - Round seeds - 75%, Wrinkled seeds - 25% (3:1)

Explanation:

Let the letter "r" stand for the alleles, where R is round seeds and r is wrinkled seeds. A genotype is an individual's genes represented through alleles. Phenotypes are how the genes express themselves. In other words, genotypes will be written using letters, the alleles, and phenotypes will be the possible outcomes of the alleles.

To find the ratios/percentages of the genotypes and phenotypes you can use a punnet squares. Both of the parent seeds have the genotypes Rr and the phenotype of round seeds.

If you create punnet square (which had four boxes in total) 1 will have RR, 2 will have Rr, and 1 will have rr. These are the ratios for the genotypes. Each box represents 25%, so the percentages will be 25, 50, and 25. Finally, 3 of these boxes (RR and Rr) will result in round seeds because those are domiant. Only the genotype rr will result in wrinkled phenotype. Therefore, the ratio is 3:1 or 75% to 25%.

You might be interested in
A plant is heterozygous for height (Tt) and red flowers (RI). What possible
Anit [1.1K]

Answer:

D.

Explanation:

3 0
2 years ago
Read 2 more answers
In which organelles does the chemical process of photosynthesis occur?
ludmilkaskok [199]
That would be the chloroplast. 
8 0
3 years ago
Read 2 more answers
Vibration due to exhaled air that results in speech is a function of the:
Bond [772]
True vocal cords is the answer <span>ʕ•ᴥ•ʔ</span>
8 0
3 years ago
The codons are carried to a ______ where the colde is translated into a sequence of amino acids
givi [52]

Answer:

Ribosome

Explanation:

i found the awnser here rehehrhr

8 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • What material (food/air) frog trachea transport? for a frog
    12·1 answer
  • Which is one function of the nucleic acid
    15·1 answer
  • Do gases sink or float
    6·2 answers
  • How do you adjust the focus of the microscope when observing organisms at high magnifications?
    5·1 answer
  • Which of the following describes chaparral shrubs?. a.. short. b.. evergreen. c.. contain flammable oils. d.. all of the above
    6·2 answers
  • Need some help on #59
    7·1 answer
  • Climate change is causing the average annual temperature to increase. Birds that have adapted to temperatures in their environme
    10·1 answer
  • How is Hydropower practical for used in business, home, or schools today?
    5·1 answer
  • Bodily energy Taoists cultivate within themselves is called:
    10·1 answer
  • Students are learning about plate tectonics and how current topographic features were formed. The students learn
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!