1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sertanlavr [38]
3 years ago
9

Why cannot all plants prepair there food?try a short answer

Biology
2 answers:
Lorico [155]3 years ago
7 0

Answer:

Non-green plants cannot make their own food because they do not have chlorophyll in their leaves which breaks down carbon dioxide and water molecules thus do not produce glucose(food).

Ilya [14]3 years ago
4 0

Answer:

to the absence of chlorophyll

You might be interested in
What other molecules are carbon atoms in after the chemical change?
Ilya [14]

Answer:Carbon dioxide molecules

Explanation:

5 0
3 years ago
Wind and water energy are both indirect forms of what other type of energy source
kupik [55]
<span> nuclear: Classify the </span>different energy sources <span>from the table according to whether they are renewable.</span>
3 0
3 years ago
Read 2 more answers
How do animal-like protists differ from plant-like protists?
Genrish500 [490]
I think its a please let me know if im wrong 
8 0
3 years ago
Read 2 more answers
In an eukaryotic cell, mitosis is followed by ?
attashe74 [19]

After Mitosis the cell completes its division by splitting its cytopplasm and re-building the last line of its cell memebrane

5 0
3 years ago
This is the process by which organisms aqcuire traits thrugh sexual reproduction
xeze [42]
The correct answer will be “Biological Evolution”
5 0
3 years ago
Other questions:
  • As energy is transferred through
    7·1 answer
  • Why is inheritance in humans harder to study than in inheritance in Mendels peas plants?
    9·1 answer
  • Pls help 40 points!!!!!!!
    11·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which two kingdoms include both one-celled and many-celled organisms?
    15·1 answer
  • The first recorded history of them dates back to 1549 when the Spanish were exploring the area.
    6·1 answer
  • An 8-kilogram bowling ball is rolling in a straight line toward you. If its momentum is 16 kg·m/sec, how fast is it traveling?
    15·1 answer
  • How is a cell a system?
    11·2 answers
  • Who could help me with finals next month ? it’ll mean the world to me .
    8·1 answer
  • FUN QUESTION maybe challenging I'm sort stuck i can't figure out!!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!