AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
DNA helicase untwists the helix at the replication origins. Then the DNA is seperated into a "Y" shape called the replication fork.
It is carried on the X chromosome.
Taking this test on Gradpoint, hope I helped.
It's important to prepare the insects properly before eating: Wash the insects. Boil, steam or fry them for at least five minutes. Eat the prepared insects directly after cooking.
The timeline of human evolution outlines the major events in the evolutionary lineage of the modern human species, Homo sapiens, throughout the history of life, beginning some 4 billion years ago down to recent evolution within H. sapiens during and since the Last Glacial Period.
