1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikki [24]
3 years ago
15

This graph shows the harbor seal population in the gulf of Maine for a twenty year period. A population of seals with unlimited

Biology
1 answer:
NeX [460]3 years ago
5 0

Answer:

Explanation:

This graph shows the harbor seal population in the gulf of Maine for a twenty year period. A population of seals with unlimited

resources will continue to grow exponentially as shown in the graph above. What are some density-dependent limiting factors that

would prevent continued exponential growth? Choose ALL that apply.

es )

You might be interested in
Landslides occur when earth materials that are no longer held by friction move down a slope with the help of gravity. I think th
xxTIMURxx [149]

Yes, the given statement is true.  

A landslide is illustrated as the movement of debris, the mass of rock, or earth down a slope. The landslides are a kind of mass wasting that signifies any down-slope movement of rock and soil under the direct effect of gravity.  

The slope movement takes place when the forces functioning on down-slope primarily because of gravity exceeds the strength of the Earth substances, which compose the slope. The causes comprise elements, which elevates the influences of down-slope forces and factors, which contribute to reduced or low strength.  


8 0
3 years ago
Which of the following is an example of regulated waste?
Debora [2.8K]

Answer:

D. A used bed sheet

Explanation:

just took the test

4 0
3 years ago
What is the function of the small intestines
Neporo4naja [7]
90% of digestion and absorption takes place in the small intestines.
the main function of the small intestines is <span>absorption of nutrients and minerals from food.</span>
4 0
3 years ago
What is the solubility of NH4Cl at approximately 50.0 oC?
Semenov [28]
We can define the solubility as the maximum amount of solute (which may be a solid, liquid or gas) that is dissolved in a solvent ( which may be a solid, liquid or gas).
The solubility of Ammonium chloride (NH₄Cl) at 50°C is 50 grams, because t<span>he </span>solubility of NH₄CL<span> is 50g /100g of water at </span>50°<span> C.</span>
4 0
3 years ago
Read 2 more answers
Match each term with its description.
wariber [46]
The right one for this is “D”
8 0
3 years ago
Other questions:
  • This organelle carries
    5·2 answers
  • The human body contains nitrogen (N2) as part of amino acids, ATP, DNA, and RNA. The
    7·1 answer
  • Why do hevier objects fall more slowly than lighter objects
    5·1 answer
  • William wanted to create a report on a geographical location with the greatest species diversity. Which ecosystem can consider f
    7·2 answers
  • 5. Explain how an enzyme changes the activation energy of a reaction.​
    5·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What are the three most abundant elements found in earth`s crust that combine to form minerals?
    11·2 answers
  • I need help with 7 help please I will give brainliest
    11·1 answer
  • Which of the following statement about gene mutation is not correct. It:
    11·1 answer
  • What is energy releasing equation ?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!