1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
baherus [9]
3 years ago
9

How do animals cause erosion.

Biology
1 answer:
Alexeev081 [22]3 years ago
7 0

Answer:

Some animals weather rocks by scraping them as they feed. Other animals change Earth's surface by burrowing into it and moving material. Too many animals in one place can destroy most of the plants, leading to faster erosion.

If too many animals graze the same land area, the animals’ hooves pull plants out by their roots. A land is overgrazed if too many animals are living there. Grazing animals can cause erosion if they are allowed to overgraze and remove too much or all of the vegetation in a pasture.

Explanation:

Hope this helped :)

You might be interested in
Which type of cell is more complex, prokaryotic or eukaryotic?
Lisa [10]
It is accually prokaryotic
7 0
3 years ago
Read 2 more answers
How do people know when they have been bitten by the vector that causes African
IceJOKER [234]

Answer:

Explanation:

African trypanosomiasis is a parasitic disease transmitted by the tsetse fly. It gets its nickname 'sleeping sickness' because symptoms can include a disturbed sleep pattern.

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What are two reasons that this research was significant?
MissTica

Answer:

The main purpose of research is to inform action, to prove a theory, and contribute to developing knowledge in a field or study.

Explanation:

4 0
4 years ago
Read 2 more answers
What is the name for a group of individuals of the same species living
inna [77]

Answer:

population is the right answer.

5 0
3 years ago
Read 2 more answers
Other questions:
  • The backbone of dna (i.e., sides of the dna "ladder") consists of
    6·2 answers
  • How is the gene for altruism passed on to later generations if it is so detrimental to an organism's well being?
    12·1 answer
  • In the presence of lidocaine, the action potential was not affected at r1 because _______.
    9·1 answer
  • In the diastole phase of the cardiac cycle, which is the correct direction of the flow of blood?Select one of the options below
    7·2 answers
  • When you go to check on your sleeping child, you observe that his eyes are moving back and forth rapidly under his eyelids. it i
    10·1 answer
  • Question 20 of 20 :
    6·1 answer
  • Which pressure is associated with blood flow to organs?
    5·1 answer
  • Choose some of these examples to create a system. Explain how the flow of matter and energy occurs in the system.
    14·1 answer
  • Select the correct answer. What are the x-intercepts of this quadratic function? g(x) = -2(x − 4)(x + 1) A. (4,0) and (1,0) B. (
    8·1 answer
  • How do the changes in the red blood cells impact homeostasis
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!