1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-Dominant- [34]
3 years ago
8

Given two areas with equal sunlight and available water. Area I has a high amount of atmospheric carbon dioxide while Area II ha

s a low amount of atmospheric carbon dioxide. How does the rate of photosynthesis in Area I compare to that in Area II?
 A) Atmospheric carbon dioxide has no affect on the rate of photosynthesis.
 B) The rate of photosynthesis increases with a decrease in carbon dioxide.
  C) The rate of photosynthesis increases with an increase in carbon dioixde.
 D) The level of carbon dioxide increases with the level of available oxygen.
Biology
2 answers:
kotegsom [21]3 years ago
6 0
As for this problem, the most probable and the most likely answer to this would be C) The rate of the photosynthesis increases with an increase in carbon dioxide.

Taking into consideration what was given that there are two areas with equal sunlight and available water. Both areas are named as Area I and Area II respectively. While Area I has a high amount of atmospheric carbon dioxide, the Area II has a low amount of atmospheric carbon dioxide. We all know that plants need carbon dioxide in order to perform photosynthesis and as a result, release oxygen to the environment. Thus, the higher the amount of carbon dioxide, with enough sunlight and available water, the higher the rate of photosynthesis will be.
zmey [24]3 years ago
3 0

Your answer is c i hope this helps

You might be interested in
A college student reads a review of the current literature on a topic in an academic research journal.She then reads an article
jenyasd209 [6]

Answer:

:) :(

Explanation:

5 0
3 years ago
Read 2 more answers
Which of the following statements is not true of the circulatory system and its transport of nutrients?
Vladimir [108]

Answer: b. Nutrients that leave the small intestine via blood are delivered first to the liver.

Explanation:

Lymph is a clear fluid that leeks out from the interstitial spaces of the cells and this comprises of electrolytes, blood proteins, and antibodies. It is pushed towards the heart from the lymphatic vessels. The nutrients from the small intestine are drained into the bloodstream and they are circulated to all parts of the body and not directly destined towards the liver.

5 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
What are reactants in the process of photosynthesis
soldi70 [24.7K]

Answer:

here is your Answer.

Explanation:

Photosynthesis requires sunlight, carbon dioxide, and water as starting reactants .

3 0
2 years ago
Read 2 more answers
How is biological diversity is increased by the origin of new species.​
Reptile [31]
Biological diversity is the variety of species in a given area. If a new species is added there are more species and therefore greater biological diversity and if one goes extinct there are less species and therefore less biological diversity.
6 0
3 years ago
Other questions:
  • Which was first launched during the Space Race?
    11·1 answer
  • Which type of bond is very important to living things, because it is weak, but does allow things to "stick together"?
    7·1 answer
  • Compare and contrast the different types of distribution.
    11·1 answer
  • We have discovered dead fish floating around our boat. we think that the dead fish are caused by a sudden increase in a red tide
    12·1 answer
  • What animals or parts of animals were used to make glues
    11·2 answers
  • Which of the following best explains why cells remove waste?
    15·1 answer
  • The central nervous system includes
    5·2 answers
  • A mutation that involves one or just a few nucleotides is known as what? A. point B. minor C. chromosomal​
    14·2 answers
  • What is the Maize C4 photosynthesis process
    11·1 answer
  • Where are the tectonic plates located on Earth?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!