1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darina [25.2K]
3 years ago
8

5) Select the best answer.

Geography
1 answer:
Aleks [24]3 years ago
3 0
Maps help geographers study spatial relationships
You might be interested in
Batay sa mga sitwasyong nabanggit ano ang nasyonalismo​
Tanzania [10]

Answer:

Hope it helps

4 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
replica car has a similarity ratio of 1:30. replica car has a width of 3.2 inches. find the width of the original car in inches
kodGreya [7K]

Answer: The width of the original car = 96 inches.

Explanation:

Given: The similarity ratio of  a replica car = 1:30

The width of the replica car = 3.2 inches.

By using the similarity ratio,

The width of the original car = 30 x (width of the replica car )

i.e. The width of the original car = 30 x 3.2 inches

i.e. The width of the original car = 96 inches

Hence, the width of the original car = 96 inches.

6 0
3 years ago
A
schepotkina [342]

Answer: Test case

Explanation:

The document that defines the software testing approach in order to achieve testing objective is referred to as the test case.

It should be noted that the test case is a document, that consist of a set of test data, the preconditions, and the expected results as well as the postconditions, which are developed for the test scenario so as to meet the testing objective.

7 0
3 years ago
Select the correct answer.
Lady_Fox [76]
They were from europe
4 0
2 years ago
Other questions:
  • The part of a line between two points on the line
    6·1 answer
  • Which of the following is not an example of human environment interaction
    7·2 answers
  • The highest point of the rocky mountains is about three miles high. true or false?
    11·1 answer
  • What is the capitil of north carolina?
    14·2 answers
  • Which of the following are characteristics of early human settlements?
    8·2 answers
  • Why is it that New York City has a greater temperature range than Eureka, CA even though they are at the same latitude ?
    13·1 answer
  • What was the biggest difference between the Earth's second atmosphere and third (present) atmosphere?
    13·2 answers
  • The type of map above is used to show borders and boundaries. It also shows capitals, cities, and towns. What kind of map is sho
    7·2 answers
  • Why is coal is called why is coal is called fossil fuel ​
    8·2 answers
  • South Africa’s contribution to world markets and the challenges it faces in improving its economy.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!