1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergey [27]
3 years ago
13

The characteristic that all lipids have in common is __________.

Biology
1 answer:
DaniilM [7]3 years ago
6 0

Answer:

they have in common is fats

You might be interested in
What the answer to these if there wrong or correct check pls
dimaraw [331]

Answer:

the second one is false

Explanation:

4 0
3 years ago
Read 2 more answers
What is it called when a drug is no longer effective but organism is susceptible in vitro?
CaHeK987 [17]

When a drug is no longer effective but an organism is susceptible in vitro, it is called intermediate.

<h3>What is it known as when a drug loses its effectiveness but an organism is still susceptible in vitro?</h3>

  • When a bacterial strain is susceptible in vitro to a concentration of an antibiotic drug that is linked to a questionable therapeutic effect, it is said that the bacterium's sensitivity to that antibiotic is intermediate. Thus, When a drug is no longer effective but an organism is susceptible in vitro, it is called intermediate.
  • The designation "intermediate" suggests that while the same antibiotic may not be sufficiently effective against the same organism if it is located in other places, such as the meninges, it may readily be eliminated in bodily compartments that are easily accessible by the medicine, such as the urinary tract.

To learn more about susceptibility refer:

brainly.com/question/28169324

#SPJ4

4 0
2 years ago
Please explain why the inoculated plates are inverted during incubation.
sasho [114]

Answer:

Petri plates are incubated upside down to prevent contamination.

Explanation:

The plates are always incubated inverted or turned upside down on their covers during storage. This is done to prevent evaporation if plaque is stored for long periods, which can affect the growth efficiency of bacteria, or allow contamination by multiplying unwanted organisms such as mold.

Once the plaques have been filled with a damp suspension of bacteria, it should be allowed to evaporate shortly before overnight incubation. However, a moderate amount of moisture will still be present. If plaque is not inverted during incubation, bacteria will not be able to attach to the culture medium properly, which will either prevent them from growing and forming colonies properly or will encourage the growth of undesirable microorganisms.

Any of these results will invalidate the experiment. In addition, any condensation or moisture can cause streaking, which will make it difficult to select and analyze separate colonies. After bacteria form colonies, plaque is also stored upside down to maintain moisture levels.

6 0
3 years ago
(04.01 LC) The way living things are organized can be represented on a chart. A portion of the organization chart is shown below
Ksju [112]
The correct answer is Organs
6 0
4 years ago
Malaria is a(n) _________ disease.” Which of the following terms could fill in the blank to make the statement true? Write “yes”
STatiana [176]

Are u in k12??.

You know the track what sites you go on


8 0
3 years ago
Other questions:
  • Competition between two species occurs when?
    8·1 answer
  • A scientist heats a piece of iron until it is glowing white-hot. He places the metal inside a metal box. He removes all of the a
    6·2 answers
  • The North American Plate is moving away from the Eurasian Plate, forming the Mid-Atlantic Ridge. Iceland offers a natural labora
    10·2 answers
  • Hemophilia is a rare bleeding disorder in which the blood doesn't clot normally. The Royal family of England has a high concentr
    14·1 answer
  • How does meiosis differ from mitosis?
    14·1 answer
  • What are the two types of basic current
    13·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • 13.1: Consider four different cellular systems that share the following characteristics. The frequency bands are 825 to 845 MHz
    14·1 answer
  • how the function of the basal cells depends on the relationship among its parts?(respiratory system ​
    13·1 answer
  • When we speak, air from our lungs rushes across the __________, causing them to vibrate.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!