1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dovator [93]
2 years ago
12

What is the mRNA transcript if the complementary DNA is TCTGAG?

Biology
1 answer:
Ghella [55]2 years ago
3 0

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

You might be interested in
Producers release carbon dioxide as waste during which process of the carbon cycle? photosynthesis respiration condensation fixa
saveliy_v [14]

Explanation:

Respiration..

the act of respiring; inhalation and exhalation of air; breathing. Biology. the sum total of the physical and chemical processes in an organism by which oxygen is conveyed to tissues and cells, and the oxidation products, carbon dioxide and water, are given off.

3 0
3 years ago
If the chloroplasts in a plant cell were destroyed, what would be the result?
Elena L [17]

<em>it would be A. The plant would no longer be able to convert sunlight into sugar.</em>

<em>Just think about It makes sense. And I am very certain and know for sure that this is the correct answer.</em>


5 0
3 years ago
Read 2 more answers
Explain how the energy of a toy car is transformed as it slides down a ramp. Give evidence that the energy of the car remains th
Rufina [12.5K]
As the toy car slides down a ramp, its potential energy was transformed into kinetic energy.
6 0
3 years ago
What is the function of the hormone progesterone? preparation of the body for maintaining pregnancy development of male secondar
Alex787 [66]

Answer:

A !!!!!!!!!!

Explanation:

Progesterone is a hormone released by the corpus luteum in the ovary. It plays important roles in the menstrual cycle and in maintaining the early stages of pregnancy. It may also be involved in the growth of certain cancers.

7 0
3 years ago
Read 2 more answers
Speciation that results from the formation of a geographic feature that isolates some members of a population from other members
Marizza181 [45]
<span>a. allopatric speciation</span>
3 0
4 years ago
Other questions:
  • Identify the most common graph types,
    9·2 answers
  • What is the function of the tomato pulp cell? Also, do they have chromosomes?
    6·1 answer
  • When you notice that someone has unusually blue eyes, you've noticed their
    14·1 answer
  • --The Y axis on a graph gives the units for the A.)control variable B.)dependent variable c.)measurement error
    5·1 answer
  • How is chemiosis used in photosynthesis?
    12·1 answer
  • Which form of government would have the MOST amount of citizen participation?
    10·2 answers
  • How does an organism obtain energy from the food they eat?
    12·1 answer
  • How do the resources available to people influence how they<br> grow food?
    7·1 answer
  • If Mr. and Mrs. Weasley are a wizard and a witch, what are their genotypes?
    15·1 answer
  • What is most likely the identity of the biome, and why?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!