1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dovator [93]
2 years ago
12

What is the mRNA transcript if the complementary DNA is TCTGAG?

Biology
1 answer:
Ghella [55]2 years ago
3 0

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

You might be interested in
Way an egg is so much larger then a sperm cell, need help.
Dmitry_Shevchenko [17]

Answer:

The egg contains both food and mitochondria in addition to its vital DNA, thats why it is much larger. The sperm cell has to be much smaller than the egg cell, because it is the one that swims. If a sperm cell were as big as an egg, it would not be able to move very fast nor very far.

3 0
3 years ago
Advantage amoeba has over a cell of a lizard in relations to their levels of organism
nignag [31]

Amoebas are single-celled organisms, which means that they are composed of just one cell. Each amoeba is a cell capable of performing all living functions by itself. They can reproduce asexually. They are protozoans with no fixed shape. Most have no hard parts and look like blobs of jelly.

8 0
4 years ago
Which Eukaryotic cell part contains directions for cell growth and reproduction?
Natali [406]
Hello.

The answer is: C.nucleus. 

It instructs and is known for  cell growth and reproduction.
5 0
3 years ago
Read 2 more answers
Which structure is directly involved in gas exchange?
Marysya12 [62]
I would say the alveoli. They are tiny air pockets in the lungs: this is where the diffusion of oxygen and carbon dioxide occurs.

Hope this helps! x
4 0
4 years ago
Read 2 more answers
How is the major conflict developed in the middle and how is the conflict resolved in the end
Kamila [148]
What is the question or paper? there isn’t really a question here if there is nothing to look at lol
7 0
3 years ago
Read 2 more answers
Other questions:
  • The parent of an 8-month-old infant tells the nurse, "while administering the medication to my child, i add a small amount of ho
    15·2 answers
  • Classify the reaction as unimolecular, bimolecular, or termolecular.
    12·2 answers
  • How does competition shape communities?
    15·1 answer
  • Which phrase defines a community?
    5·2 answers
  • Which sphingolipids have a single monosaccharide as a component? g
    5·1 answer
  • What is made up of usable amounts of metallic elements?carbonate oresilicate a mineral
    8·2 answers
  • Researchers are studying the last two phases of mitosis, anaphase and telophase, in actively dividing cancer cells. Different fl
    8·1 answer
  • All about crystals-find the missing & hidden words
    8·1 answer
  • Which of the following plant propagation methods requires sterile conditions?
    14·1 answer
  • What are the parts of animal and find their function. ​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!