1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dovator [93]
2 years ago
12

What is the mRNA transcript if the complementary DNA is TCTGAG?

Biology
1 answer:
Ghella [55]2 years ago
3 0

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

You might be interested in
How do cellular respiration and photosynthesis provide energy for an organism to function?
Juliette [100K]

Answer:

They provide energy because photosynthesis makes sugar (glucose) which results into ATP(energy). In CR (cellular resp), oxygen is broken down during the process of photosynthesis and is used in CR to make water with hydrogen bonds.

4 0
3 years ago
What is the celular division?
wel
This is when a daughter cell divides into 2 different cells . So basically the dividing of cells to offspring from the parent. 
4 0
4 years ago
A patient with burns to the skin complains of numbness and difficulty staying warm. Based on this information, diagnose which la
podryga [215]
Layers of the skin affected by the burn in this question are the epidermis and dermis.  When a burn occurs to soft-tissue, the fragile, yet strong nerve endings enter in a "protective and chaotic" mode, trying to restore a homeostatic  environment.  There is also a massive attempt from the body to thermoregulate itself.  The heat from the burn is causing the body to release excessive heat to prevent itself from over-heating.  Until the brain is signaled to slow this process, heat will rapidly exit the body, thus the difficulty keeping warm
7 0
3 years ago
Read 2 more answers
How is the small intestine designed to absorb digested food ?​
earnstyle [38]

Answer:

Small intestine is designed to more and more area for absorption of digested food and transfer into the blood for circulation throughout the body. The inner lining of small intestine has a large number of finger-like projections called villi. These villi provide a large surface area for absorption of food.

Explanation:

Hope this helps!

Have a good day or night!

3 0
3 years ago
Read 2 more answers
Which organs shown in the transparency are part of the frog's nervous system?
In-s [12.5K]
The nervous system in a frog controls the activities of the organs of the body. It also would regulate the internal environment in one's body. All the organs which are also the same parts of nervous system of a vertebrate are present in a frog. The brain,spinal chord,the sympathetic and para sympathetic nerves,cranial nerves,spinal nerves,cranial nuclei and ganglia.
7 0
4 years ago
Other questions:
  • What was the major contributor of oxygen to earth's early atmosphere? A) photosynthesis B) organic respiration C) ozone decompos
    11·2 answers
  • Brown hair is dominant over red hair. What will the genotypes and phenotypes of the offspring of a cross between a homozygous br
    8·1 answer
  • The diagram below shows part of the rock cycle which type of rock does A represent
    13·1 answer
  • This nuclear structure may be visible during interphase
    15·1 answer
  • Which event listed is most likely to cause a widespread influenza breakout?
    15·1 answer
  • Fossils help us reconstruct plant and animal life in the past as well as their evolutionary processes, which can be either slow
    7·1 answer
  • 8,9,10 I need answers pls
    15·1 answer
  • Sediments can negatively affect an aquatic ecosystem by blocking sunlight
    13·1 answer
  • Полностью воспроизводит особенности конкретной местности. 3D-принтеры позволяют создавать цветные объемные карты, которые ....
    10·1 answer
  • The _____ is an enzyme involved in the breakdown of serotonin, norepinephrine, and dopamine, and its suppression results in incr
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!