1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gelneren [198K]
3 years ago
9

A chromosome has broken, and a piece of one chromosome is translocated to a nonhomologous chromosome. This is an example of what

type of chromosomal alteration?.
Biology
1 answer:
Elis [28]3 years ago
6 0

Answer:

Unbalanced Translocation

Explanation:

An unbalanced translocation occurs when a fetus inherits a chromosome with extra or missing genetic material from a parent with a balanced translocation.

You might be interested in
True or false: Large molecules called monomers are made of smaller subunits called polymers. A True B False​
Nonamiya [84]
Answer: True!

Reason: Because monomers are long chains of reapeating subuints in Polymers
5 0
4 years ago
Read 2 more answers
What is radioactive dating?
Kazeer [188]
Is  a technique used to date materials such as rocks or carbon
4 0
3 years ago
Excitatory neurotransmitters influence the receiving neuron to _____, whereas inhibitory neurotransmitters influence the receivi
Viktor [21]

Excitatory neurotransmitters cause the neuron to fire, and Inhibitory neurotransmitters cause the neuron not to fire.

Impulses are the signals passed from one neuron to another on the action of a stimulus. The impulses passed can be electrical or chemical. Neurotransmitters are the chemical molecules that help in the transfer of impulses between two neurons.

Chemicals like epinephrine, norepinephrine, and glutamate when released from the synaptic cleft of one neuron activate the receptors of other neurons, thereby initiating the other neuron to fire. These chemicals are called excitatory neurotransmitters.

Chemicals like GABA and glycine, when released from the synaptic cleft of one neuron do not activate the receptors of other neurons and hence the neurons will not fire the impulse. These chemicals are called inhibitory neurotransmitters.

To know more about neurotransmitters, visit

brainly.com/question/26387085

#SPJ4

8 0
2 years ago
What two gases easily diffuse through the phospholipid bilayer
natima [27]

Answer:

Consider substances that can easily diffuse through the lipid bilayer of the cell membrane, such as the gases oxygen (O2) and CO2. O2 generally diffuses into cells because it is more concentrated outside of them, and CO2 typically diffuses out of cells because it is more concentrated inside of them.

6 0
3 years ago
Arrange the phases of mitosis in the correct order.
JulsSmile [24]
1. Chromosome condense (Prophase)
2. Spindle fibers form (Prophase)
3. Chromosomes allign in the center of the cell (Metaphase)
4. Chromosomes separate (Anaphase)
5. Cell membrane pinches (Telophase and Cytokenesis)
6. Spindle fibers disappear (Conclusion of Cytokenesis)
7 0
3 years ago
Read 2 more answers
Other questions:
  • The graph above was made by a South American biologist in the country of Brazil, after a long study on parrots. About 200 years
    13·2 answers
  • Who studied the role of RNA in protein synthesis, specifically in the bacteria E. coli.
    8·1 answer
  • which of the following occurs when organisms interact with other living things and their environment?
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Plz help......................​
    10·1 answer
  • The loss in genetic biodiversity due to a tornado is an example of
    5·1 answer
  • How is dna molecule replicated
    7·2 answers
  • What is the repeating subunit of starch?
    10·1 answer
  • In this project, you will analyze claims about the causes of inherited genetic variation. You will then make your own claim base
    9·1 answer
  • It's estimated that without the development of this
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!