Question
Mid-ocean ridges are steeper and less broad than rises because:
Group of answer choices
A) the rocks of the mid-ocean ridges are composed of more dense mineral than the rises.
B) the rocks of the mid-ocean ridges are composed of less dense mineral than the rises.
C) The seafloor spreading rate of ridges are faster than rises causing the oceanic crust to subside closer to the ridge axis.
D) The seafloor spreading rate of ridges are slower than rises causing the oceanic crust to subside closer to the ridge axis.
E) Every ridge is composed of continental crust.
Answer:
The correct answer is D.
Explanation:
In volcanic regions, as the molten magma flows out onto the seafloor creating new beds, the faster it flows, the less steep the mid-ocean ridge is. If however, it is slow-flowing, then oceanic lithosphere formed cool closer to the ridge axis thus making it very steep.
Cheers!
<u>Answer:</u>
Ptolemy accounted for 'retrograde motion' in his model of the solar system by introducing smaller circles named 'epicycles'.
<u>Explanation:</u>
- According to Ptolemy, the Sun and the other planets in the Solar system orbited around the Earth.
- The Greeks were convinced that Ptolemy's earlier model did not provide for backward or the retrograde motion.
- Ptolemy thought over it for a while and theorized the possibility of 'epicycles'.
- According to Ptolemy, the planets that orbited Earth also orbited another smaller point.
- The smaller orbits followed by the planets while in motion around the Earth in a larger orbit were introduced by Ptolemy as 'epicycles'.
- Until Kepler proposed his models of the functioning of the Solar system, Ptolemy's models were considered the most relevant.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Try looking the worksheet up on google it might pop up on “images...
I think the answer is D good Day now it’s D for sure have a good day
