1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anastassius [24]
2 years ago
11

Combined gas law, A gas balloon has a volume of 106L when the temperature is 318K and the pressure is 1.5 atm. What will its vol

ume be at 293 K and 2 atm.
Biology
1 answer:
vazorg [7]2 years ago
3 0

Answer: 92.66L. Explanation: Applying ideal gas equation considering the gas inside the balloon to be ideal, to get the new volume,.

Explanation: Hope This Helps! ^^

<em>From: Kenji</em>

<em></em>

<em>#LearnWithBrainly</em>

<em></em>

<em>~Have A Nice Day!~ </em>

<em></em>

<em></em>

<em></em>

<em></em>

<em></em>

<em></em>

<em></em>

<em></em>

<em>Also....</em>

<em></em>

<em></em>

<em></em>

<em>It's nice to see you cory :^</em>

You might be interested in
Which of the following statements regarding a DNA double helix is true? The amount of adenine is equal to the amount of thymine,
Elena-2011 [213]

Answer:

Option (1).

Explanation:

DNA (deoxyribo nucleic acid ) is the genetic material present in all the organisms except some viruses. DNA structure follows the Chargaff's rule.

Accoprding to Chargaff's rule, the ratio of purines to pyrimidines in a DNA molecule is equal to 1. The amount of guanine is nearly equal to the amount of cytosine whereas the amount of thymine is nearly equal to the amount of adenine.

Thus, the correct answer is option (1).

6 0
3 years ago
Using energy as the factor, what case can be made for eating vegetarian?
Shkiper50 [21]

Explanation:

One of the benefits of a vegetarian diet is a reduction in your impact on the environment. Animals store only a small fraction of the energy they extract from the food they eat, and the rest is wasted as heat.

6 0
2 years ago
We will spend a little time exploring the city with trolley cars and many hills. Where are we?
Cloud [144]
Exploring the city with trolley cars and many hills. This city is San Francisco, CA.

Trolley cars or cable cars were introduced in 1873 to enable locals to contend with many hills the city is built on. Now, tourists ride the cable cars and will be given a tour of the city. 
3 0
3 years ago
A change in the genetic make-up, appearance, and behaviors of a species over time is called
Studentka2010 [4]

Answer:

evolution

Explanation:

For example, scientists believe that monkeys have evolved to become humans.

This clearly has happened over many millions of years.

Monkeys look really different from humans (don't you think!?).

This was just a random example that came to my head.

Hope this helps.

-Gumina

8 0
3 years ago
What organelle could you hypothesize occur in large numbers in muscle cells?
zhannawk [14.2K]

Answer: D

Explanation:

it just is D

4 0
3 years ago
Read 2 more answers
Other questions:
  • This term takes into account both the actual emission of carbon by an act, but also the
    14·1 answer
  • Which of the following hormones has a different effect when it is released in males instead of females?
    9·2 answers
  • Summarizing Activities and Ideas
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • 1.
    6·1 answer
  • • nitrogen-fixing • producer • biosphere • consumer • biotic factor • heat • condensation • parasitism • commensalism • neritic
    10·1 answer
  • Out of these possibilities, and they could have more than one answer, what kinds of energy are these?
    14·1 answer
  • Jordan builds a terrarium. But, the soil he uses does not have many nutrients. How could this affect life in the terrarium?
    10·1 answer
  • How much photosynthesis occurs in the ocean?
    14·1 answer
  • Identify an organism that is present in your local ecosystem, and discuss two limiting factors that may affect this organism.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!